Transcript: Human XM_017010353.2

PREDICTED: Homo sapiens erythrocyte membrane protein band 4.1 like 2 (EPB41L2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPB41L2 (2037)
Length:
3558
CDS:
112..3285

Additional Resources:

NCBI RefSeq record:
XM_017010353.2
NBCI Gene record:
EPB41L2 (2037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117095 GCCAGTGTAATCACAGTAGAA pLKO.1 2680 CDS 100% 4.950 6.930 N EPB41L2 n/a
2 TRCN0000288853 GCCAGTGTAATCACAGTAGAA pLKO_005 2680 CDS 100% 4.950 6.930 N EPB41L2 n/a
3 TRCN0000311604 TAGTGAACTCAAGCGCAATTT pLKO_005 2055 CDS 100% 13.200 9.240 N EPB41L2 n/a
4 TRCN0000117094 CCAAAGTCTTATGAAGGATTT pLKO.1 1791 CDS 100% 10.800 7.560 N EPB41L2 n/a
5 TRCN0000288856 CCAAAGTCTTATGAAGGATTT pLKO_005 1791 CDS 100% 10.800 7.560 N EPB41L2 n/a
6 TRCN0000117093 GCCTACTGAATTAGTAAGTAA pLKO.1 603 CDS 100% 5.625 3.938 N EPB41L2 n/a
7 TRCN0000288855 GCCTACTGAATTAGTAAGTAA pLKO_005 603 CDS 100% 5.625 3.938 N EPB41L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10802 pDONR223 100% 59.8% 58.4% None 1831_2196del;2236delA;2267_3171del n/a
2 ccsbBroad304_10802 pLX_304 0% 59.8% 58.4% V5 1831_2196del;2236delA;2267_3171del n/a
3 TRCN0000471036 TAGAGCCGATTGATCGTACCCGCC pLX_317 25.8% 59.8% 58.4% V5 1831_2196del;2236delA;2267_3171del n/a
Download CSV