Transcript: Human XM_017010664.2

PREDICTED: Homo sapiens WD repeat domain 27 (WDR27), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR27 (253769)
Length:
5590
CDS:
703..2982

Additional Resources:

NCBI RefSeq record:
XM_017010664.2
NBCI Gene record:
WDR27 (253769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412866 CAGTCTGCACAGTTCTATTAT pLKO_005 2599 CDS 100% 15.000 21.000 N WDR27 n/a
2 TRCN0000431191 CCAACAGCCTCAGGCTTATAA pLKO_005 5525 3UTR 100% 15.000 21.000 N WDR27 n/a
3 TRCN0000424520 AGCTACTGAGGTATCACATTG pLKO_005 2660 CDS 100% 10.800 15.120 N WDR27 n/a
4 TRCN0000121532 CTGGATATTGAGCAGCGATTT pLKO.1 1147 CDS 100% 10.800 15.120 N WDR27 n/a
5 TRCN0000144600 GATGTTAATAACCGCCACAAA pLKO.1 1192 CDS 100% 4.950 6.930 N WDR27 n/a
6 TRCN0000425437 AGTGGGCTTATTCGTATTTAA pLKO_005 1770 CDS 100% 15.000 10.500 N WDR27 n/a
7 TRCN0000144221 CAGTGGGCTTATTCGTATTTA pLKO.1 1769 CDS 100% 15.000 10.500 N WDR27 n/a
8 TRCN0000417919 GAGCAGGTTGAAGTAACATTT pLKO_005 1648 CDS 100% 13.200 9.240 N WDR27 n/a
9 TRCN0000121951 CTGCTTTGTATTACAAGGATT pLKO.1 1814 CDS 100% 4.950 3.465 N WDR27 n/a
10 TRCN0000144265 CTGGATGAATGTAGAGAGAAA pLKO.1 1003 CDS 100% 4.950 3.465 N WDR27 n/a
11 TRCN0000141707 CGTGGAAGTGTTTGACCTCAA pLKO.1 2835 CDS 100% 4.050 2.835 N WDR27 n/a
12 TRCN0000145527 GCTGCTTTGTATTACAAGGAT pLKO.1 1813 CDS 100% 3.000 2.100 N WDR27 n/a
13 TRCN0000122494 CCTGTCCATCAAATCTGCCAA pLKO.1 2899 CDS 100% 2.640 1.848 N WDR27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13452 pDONR223 100% 72.6% 70.9% None (many diffs) n/a
2 ccsbBroad304_13452 pLX_304 0% 72.6% 70.9% V5 (many diffs) n/a
3 TRCN0000475194 CTACGGATGGCCGCCCGCTAGTGC pLX_317 15% 72.6% 70.9% V5 (many diffs) n/a
Download CSV