Transcript: Human XM_017010689.1

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor rho1 subunit (GABRR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRR1 (2569)
Length:
2751
CDS:
307..1485

Additional Resources:

NCBI RefSeq record:
XM_017010689.1
NBCI Gene record:
GABRR1 (2569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422291 GCGACTGATGTTAGTTGTTAC pLKO_005 1728 3UTR 100% 10.800 15.120 N GABRR1 n/a
2 TRCN0000048664 GTCCACGAGATGTCTAAGAAA pLKO.1 43 5UTR 100% 5.625 7.875 N GABRR1 n/a
3 TRCN0000432508 ACACCCACGCCATTGATAAAT pLKO_005 1397 CDS 100% 15.000 10.500 N GABRR1 n/a
4 TRCN0000429753 GAGGATAGATGACCATGATTT pLKO_005 282 5UTR 100% 13.200 9.240 N GABRR1 n/a
5 TRCN0000420490 ACATGGACTTCAGCCGATTTC pLKO_005 641 CDS 100% 10.800 7.560 N GABRR1 n/a
6 TRCN0000048667 CACAAGCAAGTCAGCCCAATT pLKO.1 205 5UTR 100% 10.800 7.560 N GABRR1 n/a
7 TRCN0000420729 GCACTTATTAACCATCTATTG pLKO_005 1662 3UTR 100% 10.800 7.560 N GABRR1 n/a
8 TRCN0000048665 CAGCTATGTGAGCATGAGAAT pLKO.1 1374 CDS 100% 4.950 3.465 N GABRR1 n/a
9 TRCN0000048666 GACTCCTTAAAGACAGATGAA pLKO.1 748 CDS 100% 4.950 3.465 N GABRR1 n/a
10 TRCN0000048663 CCAGTTCCTCATTCAGGAATT pLKO.1 783 CDS 100% 0.000 0.000 N GABRR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10834 pDONR223 100% 82.5% 82.7% None 0_1ins246;177C>T;924G>A n/a
2 ccsbBroad304_10834 pLX_304 0% 82.5% 82.7% V5 0_1ins246;177C>T;924G>A n/a
3 TRCN0000478196 AGCATTCCAACAGCCTCCTAAAAT pLX_317 19.3% 82.5% 82.7% V5 0_1ins246;177C>T;924G>A n/a
4 TRCN0000489097 CTGTGGAAGGAACAAATTACATTC pLX_317 19.2% 81.6% 81.8% V5 (not translated due to prior stop codon) 0_1ins261;177C>T;924G>A n/a
Download CSV