Transcript: Human XM_017010728.1

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 4 (FBXL4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL4 (26235)
Length:
8194
CDS:
1312..2451

Additional Resources:

NCBI RefSeq record:
XM_017010728.1
NBCI Gene record:
FBXL4 (26235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118338 CCGAATTAGTACGCCTTGAAT pLKO.1 1709 CDS 100% 5.625 7.875 N FBXL4 n/a
2 TRCN0000118340 CGAATTAGTACGCCTTGAATT pLKO.1 1710 CDS 100% 0.000 0.000 N FBXL4 n/a
3 TRCN0000118337 GCAATAAAGTATCGTGGCATT pLKO.1 2770 3UTR 100% 4.050 3.240 N FBXL4 n/a
4 TRCN0000118339 GCCACTTTCTTAATGAAACTT pLKO.1 1739 CDS 100% 5.625 3.938 N FBXL4 n/a
5 TRCN0000118341 GCCAGGACTATGTGGAACTTA pLKO.1 877 5UTR 100% 5.625 3.938 N FBXL4 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5850 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 3857 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02936 pDONR223 100% 61% 61% None 0_1ins726 n/a
2 ccsbBroad304_02936 pLX_304 0% 61% 61% V5 0_1ins726 n/a
3 TRCN0000479278 ATAAATAATATTGACGATCGAGTG pLX_317 22.4% 61% 61% V5 0_1ins726 n/a
Download CSV