Construct: ORF TRCN0000479278
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015447.1_s317c1
- Derived from:
- ccsbBroadEn_02936
- DNA Barcode:
- ATAAATAATATTGACGATCGAGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL4 (26235)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479278
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 26235 | FBXL4 | F-box and leucine rich repe... | NM_001278716.2 | 100% | 100% | |
2 | human | 26235 | FBXL4 | F-box and leucine rich repe... | NM_012160.4 | 100% | 100% | |
3 | human | 26235 | FBXL4 | F-box and leucine rich repe... | XM_017010726.1 | 100% | 100% | |
4 | human | 26235 | FBXL4 | F-box and leucine rich repe... | XM_005266930.3 | 96.1% | 96.1% | 1316_1317ins72 |
5 | human | 26235 | FBXL4 | F-box and leucine rich repe... | XM_017010727.2 | 96.1% | 96.1% | 1316_1317ins72 |
6 | human | 26235 | FBXL4 | F-box and leucine rich repe... | XM_017010728.1 | 61% | 61% | 0_1ins726 |
7 | human | 26235 | FBXL4 | F-box and leucine rich repe... | XM_011535748.3 | 60.8% | 59.4% | (many diffs) |
8 | human | 26235 | FBXL4 | F-box and leucine rich repe... | NR_103837.2 | 31.3% | (many diffs) | |
9 | human | 26235 | FBXL4 | F-box and leucine rich repe... | NR_103836.2 | 19.1% | 1_331del;841_842ins346;1849_7594del | |
10 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | NM_172988.4 | 88.4% | 93.3% | (many diffs) |
11 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | XM_006537953.2 | 88.4% | 93.3% | (many diffs) |
12 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | XM_017320233.1 | 82.1% | 84.5% | (many diffs) |
13 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | XR_390324.2 | 63.9% | (many diffs) | |
14 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | NR_104380.1 | 62.9% | (many diffs) | |
15 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | NR_104379.1 | 61.5% | (many diffs) | |
16 | mouse | 269514 | Fbxl4 | F-box and leucine-rich repe... | NR_104378.1 | 44.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1932
- ORF length:
- 1863
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcaccggtc tttcccatgt taacagttct gaccatgttt tattatatat 121 gccttcggcg ccgagccagg acagctacaa gaggagaaat gatgaacacc catagagcta 181 tagaatcaaa cagccagact tcccctctca atgcagaggt agtccagtat gccaaagaag 241 tagtggattt cagttcccat tatggaagtg agaatagtat gtcctatact atgtggaatt 301 tggctggtgt accaaatgta ttcccaagtt ctggtgactt tactcagaca gctgtgtttc 361 gaacttatgg gacatggtgg gatcagtgtc ctagtgcttc cttgccattc aagaggacgc 421 cacctaattt tcagagccag gactatgtgg aacttacttt tgaacaacag gtgtatccta 481 cagctgtaca tgttctagaa acctatcatc ccggagcagt cattagaatt ctcgcttgtt 541 ctgcaaatcc ttattcccca aatccaccag ctgaagtaag atgggagatt ctttggtcag 601 agagacctac gaaggtgaat gcttcccaag ctcgccagtt taaaccttgt attaagcaga 661 taaatttccc cacaaatctt atacgactgg aagtaaatag ttctcttctg gaatattaca 721 ctgaattaga tgcagttgtg ctacatggtg tgaaggacaa gccagtgctt tctctcaaga 781 cttcacttat tgacatgaat gatatagaag atgatgccta tgcagaaaag gatggttgtg 841 gaatggacag tcttaacaaa aagtttagca gtgctgtcct cggggaaggg ccaaataatg 901 ggtattttga taaactacct tatgagctta ttcagctgat tctgaatcat cttacactac 961 cagacctgtg tagattagca cagacttgca aactactgag ccagcattgc tgtgatcctc 1021 tgcaatacat ccacctcaat ctgcaaccat actgggcaaa actagatgac acttctctgg 1081 aatttctaca gtctcgctgc actcttgtcc agtggcttaa tttatcttgg actggcaata 1141 gaggcttcat ctctgttgca ggatttagca ggtttctgaa ggtttgtgga tccgaattag 1201 tacgccttga attgtcttgc agccactttc ttaatgaaac ttgcttagaa gttatttctg 1261 agatgtgtcc aaatctacag gccttaaatc tctcctcctg tgataagcta ccacctcaag 1321 ctttcaacca cattgccaag ttatgcagcc ttaaacgact tgttctctat cgaacaaaag 1381 tagagcaaac agcactgctc agcattttga acttctgttc agagcttcag cacctcagtt 1441 taggcagttg tgtcatgatt gaagactatg atgtgatagc tagcatgata ggagccaagt 1501 gtaaaaaact ccggaccctG GATCTGTGGA GATGTAAGAA TATTACTGAG AATGGAATAG 1561 CAGAACTGGC TTCTGGGTGT CCACTACTGG AGGAGCTTGA CCTTGGCTGG TGCCCAACTC 1621 TGCAGAGCAG CACCGGGTGC TTCACCAGAC TGGCACACCA GCTCCCAAAC TTGCAAAAAC 1681 TCTTTCTTAC AGCTAATAGA TCTGTGTGTG ACACAGACAT TGATGAATTG GCATGTAATT 1741 GTACCAGGTT ACAGCAGCTG GACATATTAG GAACAAGAAT GGTAAGTCCG GCATCCTTAA 1801 GAAAACTCCT GGAATCTTGT AAAGATCTTT CTTTACTTGA TGTGTCCTTC TGTTCGCAGA 1861 TTGATAACAG AGCTGTGCTA GAACTGAATG CAAGCTTTCC AAAAGTGTTC ATAAAAAAGA 1921 GCTTTACTCA GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1981 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 2041 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAATA AATAATATTG ACGATCGAGT 2101 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t