Transcript: Human XM_017010733.1

PREDICTED: Homo sapiens regulator of G protein signaling 17 (RGS17), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS17 (26575)
Length:
1142
CDS:
187..666

Additional Resources:

NCBI RefSeq record:
XM_017010733.1
NBCI Gene record:
RGS17 (26575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036806 CCCAACAACACCTGTTGCTTT pLKO.1 256 CDS 100% 0.495 0.396 N RGS17 n/a
2 TRCN0000036805 GCTAGGATGATATATGAAGAT pLKO.1 583 CDS 100% 4.950 3.465 N RGS17 n/a
3 TRCN0000286919 GCTAGGATGATATATGAAGAT pLKO_005 583 CDS 100% 4.950 3.465 N RGS17 n/a
4 TRCN0000036808 GAATACAGTGAAGAGAACCTA pLKO.1 499 CDS 100% 3.000 2.100 N RGS17 n/a
5 TRCN0000286920 GAATACAGTGAAGAGAACCTA pLKO_005 499 CDS 100% 3.000 2.100 N RGS17 n/a
6 TRCN0000294270 GGCTTGCTTGTGAAGACTTAA pLKO_005 527 CDS 100% 13.200 7.920 N RGS17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14110 pDONR223 100% 73.3% 3.3% None (many diffs) n/a
2 ccsbBroad304_14110 pLX_304 0% 73.3% 3.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468023 CATCGGGCAGCAATTCCGGAGTTC pLX_317 72.8% 73.3% 3.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV