Transcript: Human XM_017010789.1

PREDICTED: Homo sapiens myosin regulatory light chain interacting protein (MYLIP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYLIP (29116)
Length:
1627
CDS:
238..1536

Additional Resources:

NCBI RefSeq record:
XM_017010789.1
NBCI Gene record:
MYLIP (29116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033820 CGACTGGGAATCATAGAAGTT pLKO.1 334 CDS 100% 4.950 3.960 N MYLIP n/a
2 TRCN0000282500 CCAGAACACTGCCAAGTATAA pLKO_005 633 CDS 100% 13.200 9.240 N MYLIP n/a
3 TRCN0000263125 AGGTGAAAGTTTATGGCTAAA pLKO_005 387 CDS 100% 10.800 7.560 N MYLIP n/a
4 TRCN0000033823 CCCAATTAATAGGATAGCTTA pLKO.1 888 CDS 100% 4.950 3.465 N MYLIP n/a
5 TRCN0000033821 CCTTGGCAAGAAATATGTCTT pLKO.1 1155 CDS 100% 4.950 3.465 N MYLIP n/a
6 TRCN0000033819 GCTTAAACTTAGAGTCAAGTT pLKO.1 456 CDS 100% 0.495 0.347 N MYLIP n/a
7 TRCN0000033822 CCAGACCAAGTTTGGAGACTA pLKO.1 609 CDS 100% 4.950 2.970 N MYLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03083 pDONR223 100% 94.5% 92.8% None (many diffs) n/a
2 TRCN0000491716 ACTCGGCCCTCCATACGACGGATG pLX_317 25.6% 94.5% 92.8% V5 (many diffs) n/a
Download CSV