Transcript: Human XM_017010798.1

PREDICTED: Homo sapiens hypocretin receptor 2 (HCRTR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HCRTR2 (3062)
Length:
1733
CDS:
271..1656

Additional Resources:

NCBI RefSeq record:
XM_017010798.1
NBCI Gene record:
HCRTR2 (3062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378284 GTGCTGCGAATCCAATTATTT pLKO_005 1340 CDS 100% 15.000 21.000 N HCRTR2 n/a
2 TRCN0000011674 GCTGCGAATCCAATTATTTAT pLKO.1 1342 CDS 100% 15.000 12.000 N HCRTR2 n/a
3 TRCN0000357471 CAATTTGCTATCTACCAATTA pLKO_005 1211 CDS 100% 13.200 9.240 N HCRTR2 n/a
4 TRCN0000009056 GAAGTCCTTGACCACTCAAAT pLKO.1 1482 CDS 100% 13.200 9.240 N HCRTR2 n/a
5 TRCN0000378243 TCAGCAACTTTGATAACATAT pLKO_005 1502 CDS 100% 13.200 9.240 N HCRTR2 n/a
6 TRCN0000009054 GATGTTTAAGAGCACAGCAAA pLKO.1 750 CDS 100% 4.950 3.465 N HCRTR2 n/a
7 TRCN0000009055 CCAAGATGTACCACATCTGTT pLKO.1 929 CDS 100% 0.495 0.347 N HCRTR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489370 AAGTAGCTGAAACAACCTACGTTC pLX_317 28.6% 96.2% 96% V5 922A>G;1333_1383delinsG n/a
2 TRCN0000487861 TCCATACTCTCCCACAGATCGTAG pLX_317 21.6% 96.2% 96% V5 (not translated due to prior stop codon) 922A>G;1333_1383del n/a
Download CSV