Transcript: Human XM_017010830.1

PREDICTED: Homo sapiens epithelial cell transforming 2 like (ECT2L), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECT2L (345930)
Length:
3252
CDS:
319..2130

Additional Resources:

NCBI RefSeq record:
XM_017010830.1
NBCI Gene record:
ECT2L (345930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268689 ACTACGTAAGAAGGAGTTATT pLKO_005 903 CDS 100% 13.200 18.480 N ECT2L n/a
2 TRCN0000268646 ACGCTTCATTTCTCTATATAT pLKO_005 564 CDS 100% 15.000 10.500 N ECT2L n/a
3 TRCN0000268647 GGCACAGAGCATCGGAATATT pLKO_005 1329 CDS 100% 15.000 10.500 N ECT2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05500 pDONR223 100% 59.1% 58.6% None (many diffs) n/a
2 ccsbBroad304_05500 pLX_304 0% 59.1% 58.6% V5 (many diffs) n/a
3 TRCN0000476145 AGCCGGTTCGCAAAATTCCTTCCC pLX_317 14.5% 59.1% 58.6% V5 (many diffs) n/a
Download CSV