Transcript: Human XM_017010868.1

PREDICTED: Homo sapiens male-enhanced antigen 1 (MEA1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEA1 (4201)
Length:
903
CDS:
37..465

Additional Resources:

NCBI RefSeq record:
XM_017010868.1
NBCI Gene record:
MEA1 (4201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138968 CAACAGTAGTTCTAGGAGGAG pLKO.1 41 CDS 100% 2.160 3.024 N MEA1 n/a
2 TRCN0000440431 GCTGACATCCAGGATCGAATC pLKO_005 277 CDS 100% 6.000 4.800 N MEA1 n/a
3 TRCN0000438131 AGGGAGCTACAGCGTTGAACA pLKO_005 356 CDS 100% 4.950 3.465 N MEA1 n/a
4 TRCN0000122480 CTGAACCAAGATCCTGAACAA pLKO.1 214 CDS 100% 4.950 3.465 N MEA1 n/a
5 TRCN0000139263 CGTTGAACAACCACAGCTCTA pLKO.1 368 CDS 100% 4.050 2.835 N MEA1 n/a
6 TRCN0000416138 ATGGGCCCTGAGCGTATCTTC pLKO_005 67 CDS 100% 1.650 1.155 N MEA1 n/a
7 TRCN0000139708 CATTTGCCAGACCCACCATTA pLKO.1 313 CDS 100% 10.800 6.480 N MEA1 n/a
8 TRCN0000140319 CCTGAACCAAGATCCTGAACA pLKO.1 213 CDS 100% 4.950 2.970 N MEA1 n/a
9 TRCN0000140258 GAAGATGAAGATGAGGAGGGA pLKO.1 340 CDS 100% 0.660 0.330 Y MEA1 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 719 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00994 pDONR223 100% 74% 65.4% None (many diffs) n/a
2 ccsbBroad304_00994 pLX_304 0% 74% 65.4% V5 (many diffs) n/a
3 TRCN0000479059 GGATACACTCTCTCCACATCCCTT pLX_317 70.4% 74% 65.4% V5 (many diffs) n/a
Download CSV