Transcript: Human XM_017010917.1

PREDICTED: Homo sapiens transcription factor B1, mitochondrial (TFB1M), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFB1M (51106)
Length:
2814
CDS:
255..1010

Additional Resources:

NCBI RefSeq record:
XM_017010917.1
NBCI Gene record:
TFB1M (51106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423946 GCAATGTTCGACACATCTTTA pLKO_005 580 CDS 100% 13.200 18.480 N TFB1M n/a
2 TRCN0000021040 CGCAGAGAATTACAGACTCTA pLKO.1 989 CDS 100% 4.950 3.960 N TFB1M n/a
3 TRCN0000419578 CCTCCAAATGTACATATTATT pLKO_005 366 CDS 100% 15.000 10.500 N TFB1M n/a
4 TRCN0000021039 GCAGACATAGACCCTACTCTT pLKO.1 819 CDS 100% 4.950 3.465 N TFB1M n/a
5 TRCN0000021042 GCTGAACTTCTGGTGGTTGAA pLKO.1 204 5UTR 100% 4.950 3.465 N TFB1M n/a
6 TRCN0000021043 CCACAACTCTTTGCATATAAT pLKO.1 912 CDS 100% 15.000 9.000 N TFB1M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03207 pDONR223 100% 72.5% 72.5% None 0_1ins285 n/a
2 ccsbBroad304_03207 pLX_304 0% 72.5% 72.5% V5 0_1ins285 n/a
3 TRCN0000473484 ACTGCATTCTTTTGTGGAGTTTCA pLX_317 36% 72.5% 72.5% V5 0_1ins285 n/a
Download CSV