Transcript: Human XM_017011246.1

PREDICTED: Homo sapiens valyl-tRNA synthetase 1 (VARS), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VARS1 (7407)
Length:
3035
CDS:
911..2959

Additional Resources:

NCBI RefSeq record:
XM_017011246.1
NBCI Gene record:
VARS1 (7407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293635 ATCGCATCCCAGCCTACTTTG pLKO_005 1350 CDS 100% 10.800 15.120 N VARS1 n/a
2 TRCN0000045849 CCTCGTGTCCTTTGCCTATAA pLKO.1 801 5UTR 100% 13.200 9.240 N VARS1 n/a
3 TRCN0000286194 CCTCGTGTCCTTTGCCTATAA pLKO_005 801 5UTR 100% 13.200 9.240 N VARS1 n/a
4 TRCN0000045850 CTTCCCATTGTCTTCGATGAA pLKO.1 881 5UTR 100% 4.950 3.465 N VARS1 n/a
5 TRCN0000286187 CTTCCCATTGTCTTCGATGAA pLKO_005 881 5UTR 100% 4.950 3.465 N VARS1 n/a
6 TRCN0000045851 GTCTACTTGGAGTGCCTGAAA pLKO.1 2237 CDS 100% 4.950 3.465 N VARS1 n/a
7 TRCN0000286184 GTCTACTTGGAGTGCCTGAAA pLKO_005 2237 CDS 100% 4.950 3.465 N VARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07126 pDONR223 100% 53.9% 53.9% None 0_1ins1746 n/a
2 ccsbBroad304_07126 pLX_304 0% 53.9% 53.9% V5 0_1ins1746 n/a
3 TRCN0000478609 GGGGTTCGCCCGCCTTGATCATTC pLX_317 9.4% 53.9% 53.9% V5 0_1ins1746 n/a
Download CSV