Transcript: Human XM_017011467.1

PREDICTED: Homo sapiens muscular LMNA interacting protein (MLIP), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLIP (90523)
Length:
7250
CDS:
176..2953

Additional Resources:

NCBI RefSeq record:
XM_017011467.1
NBCI Gene record:
MLIP (90523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418788 GTCATCCAATGGTGGCTATTC pLKO_005 2892 CDS 100% 10.800 15.120 N MLIP n/a
2 TRCN0000136123 GAAGATAACAGCGACCTCTTT pLKO.1 2654 CDS 100% 4.950 6.930 N MLIP n/a
3 TRCN0000423763 TGTCTCGCTCCATCCTTTATA pLKO_005 2707 CDS 100% 15.000 10.500 N MLIP n/a
4 TRCN0000425898 AGAGAGAGACCAAGCGAAATT pLKO_005 472 CDS 100% 13.200 9.240 N MLIP n/a
5 TRCN0000430897 GAAACTGTAAATAGGTCTAAA pLKO_005 413 CDS 100% 13.200 9.240 N MLIP n/a
6 TRCN0000341594 TGACTAAGCCTGGAGTAATTC pLKO_005 2553 CDS 100% 13.200 9.240 N Mlip n/a
7 TRCN0000137348 GCCAAACCTCTGATCTTCACA pLKO.1 293 CDS 100% 3.000 2.100 N MLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14334 pDONR223 100% 24.8% 23.6% None (many diffs) n/a
2 ccsbBroad304_14334 pLX_304 0% 24.8% 23.6% V5 (many diffs) n/a
3 TRCN0000472297 TCATACACCCCACCGAACTATCCG pLX_317 62% 24.8% 23.6% V5 (many diffs) n/a
Download CSV