Transcript: Human XM_017011470.1

PREDICTED: Homo sapiens muscular LMNA interacting protein (MLIP), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLIP (90523)
Length:
5833
CDS:
328..1536

Additional Resources:

NCBI RefSeq record:
XM_017011470.1
NBCI Gene record:
MLIP (90523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418788 GTCATCCAATGGTGGCTATTC pLKO_005 1475 CDS 100% 10.800 15.120 N MLIP n/a
2 TRCN0000136123 GAAGATAACAGCGACCTCTTT pLKO.1 1237 CDS 100% 4.950 6.930 N MLIP n/a
3 TRCN0000423763 TGTCTCGCTCCATCCTTTATA pLKO_005 1290 CDS 100% 15.000 10.500 N MLIP n/a
4 TRCN0000425898 AGAGAGAGACCAAGCGAAATT pLKO_005 561 CDS 100% 13.200 9.240 N MLIP n/a
5 TRCN0000430897 GAAACTGTAAATAGGTCTAAA pLKO_005 502 CDS 100% 13.200 9.240 N MLIP n/a
6 TRCN0000341594 TGACTAAGCCTGGAGTAATTC pLKO_005 1136 CDS 100% 13.200 9.240 N Mlip n/a
7 TRCN0000137348 GCCAAACCTCTGATCTTCACA pLKO.1 382 CDS 100% 3.000 2.100 N MLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14334 pDONR223 100% 57.9% 57.4% None (many diffs) n/a
2 ccsbBroad304_14334 pLX_304 0% 57.9% 57.4% V5 (many diffs) n/a
3 TRCN0000472297 TCATACACCCCACCGAACTATCCG pLX_317 62% 57.9% 57.4% V5 (many diffs) n/a
Download CSV