Transcript: Human XM_017011546.2

PREDICTED: Homo sapiens KIAA0319 (KIAA0319), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0319 (9856)
Length:
4318
CDS:
244..3204

Additional Resources:

NCBI RefSeq record:
XM_017011546.2
NBCI Gene record:
KIAA0319 (9856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155844 CGGCTGGAGATAACCTAATTA pLKO.1 1256 CDS 100% 15.000 21.000 N KIAA0319 n/a
2 TRCN0000268037 CCCAATAATTCCATTACTTTG pLKO_005 2437 CDS 100% 10.800 7.560 N D130043K22Rik n/a
3 TRCN0000154635 CCATCAGGTCTTATCTCACTT pLKO.1 527 CDS 100% 4.950 3.465 N KIAA0319 n/a
4 TRCN0000156255 CGCTGCATTTGCTCTCACTTA pLKO.1 3028 CDS 100% 4.950 3.465 N KIAA0319 n/a
5 TRCN0000154797 GCAGCCAAAGTACAGATGATA pLKO.1 1610 CDS 100% 5.625 3.375 N KIAA0319 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07497 pDONR223 100% 90.9% 88.7% None (many diffs) n/a
2 ccsbBroad304_07497 pLX_304 0% 90.9% 88.7% V5 (many diffs) n/a
3 TRCN0000476438 CCGCGCCCGGTTAGCCATATAGTT pLX_317 8.9% 90.9% 88.7% V5 (many diffs) n/a
Download CSV