Transcript: Human XM_017011863.2

PREDICTED: Homo sapiens cadherin related family member 3 (CDHR3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDHR3 (222256)
Length:
6756
CDS:
911..3022

Additional Resources:

NCBI RefSeq record:
XM_017011863.2
NBCI Gene record:
CDHR3 (222256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416129 TAACCTAGCAGCCGGCAATAA pLKO_005 1621 CDS 100% 13.200 18.480 N CDHR3 n/a
2 TRCN0000435988 ACGACGAAGTCCCTCGCTTTA pLKO_005 1053 CDS 100% 10.800 15.120 N CDHR3 n/a
3 TRCN0000418477 CGTGTACCTGGTCGTCCTATT pLKO_005 2545 CDS 100% 10.800 15.120 N CDHR3 n/a
4 TRCN0000055891 CCAGGTAACGTCAACAATCAT pLKO.1 2186 CDS 100% 5.625 7.875 N CDHR3 n/a
5 TRCN0000422892 TTGTACTCCAAACTCTTATTT pLKO_005 2059 CDS 100% 15.000 12.000 N CDHR3 n/a
6 TRCN0000431181 TCCAGATGAACACTATCTTTG pLKO_005 2676 CDS 100% 10.800 7.560 N CDHR3 n/a
7 TRCN0000055888 CGCATCCAGATAACCTTCATT pLKO.1 1346 CDS 100% 5.625 3.938 N CDHR3 n/a
8 TRCN0000055889 CGTGCCGTTTGTCATCACTTT pLKO.1 2497 CDS 100% 4.950 3.465 N CDHR3 n/a
9 TRCN0000055892 GACCTAAACAAGTTCTGCTTT pLKO.1 1460 CDS 100% 4.950 3.465 N CDHR3 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5218 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5215 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09879 pDONR223 100% 79.4% 79.4% None 0_1ins546 n/a
2 ccsbBroad304_09879 pLX_304 0% 79.4% 79.4% V5 0_1ins546 n/a
3 TRCN0000467304 CCATAACCTGAGTTTTTTTGTAAA pLX_317 15.3% 79.4% 79.4% V5 0_1ins546 n/a
Download CSV