Transcript: Human XM_017011988.1

PREDICTED: Homo sapiens VPS41 subunit of HOPS complex (VPS41), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS41 (27072)
Length:
2220
CDS:
115..1524

Additional Resources:

NCBI RefSeq record:
XM_017011988.1
NBCI Gene record:
VPS41 (27072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034327 CGACCAAACTTACTTCCCTTT pLKO.1 832 CDS 100% 4.050 5.670 N VPS41 n/a
2 TRCN0000034324 CCATTGACAAACCACCATTTA pLKO.1 1067 CDS 100% 13.200 9.240 N VPS41 n/a
3 TRCN0000287054 CCATTGACAAACCACCATTTA pLKO_005 1067 CDS 100% 13.200 9.240 N VPS41 n/a
4 TRCN0000307325 TCATCTATTCCTGTACTAATG pLKO_005 1656 3UTR 100% 10.800 7.560 N VPS41 n/a
5 TRCN0000379556 AGTTGATCCACAAGCATAATC pLKO_005 581 CDS 100% 13.200 7.920 N VPS41 n/a
6 TRCN0000111609 CCACTCATCTATGAAATGATT pLKO.1 331 CDS 100% 5.625 3.938 N Vps41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02989 pDONR223 100% 54.4% 54% None (many diffs) n/a
2 ccsbBroad304_02989 pLX_304 0% 54.4% 54% V5 (many diffs) n/a
3 TRCN0000472078 CAGTGCCTTAAGAAGGGCCGATCT pLX_317 17.7% 54.4% 54% V5 (many diffs) n/a
Download CSV