Transcript: Human XM_017011990.1

PREDICTED: Homo sapiens Bardet-Biedl syndrome 9 (BBS9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BBS9 (27241)
Length:
4906
CDS:
228..2939

Additional Resources:

NCBI RefSeq record:
XM_017011990.1
NBCI Gene record:
BBS9 (27241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160034 CTCGAATTACTGTTCTTGCTT pLKO.1 1969 CDS 100% 3.000 4.200 N BBS9 n/a
2 TRCN0000161053 GCTCTGCGATAGATTATCCAA pLKO.1 2654 CDS 100% 3.000 4.200 N BBS9 n/a
3 TRCN0000159212 GTAGAACAAGACTCTACAGAA pLKO.1 2778 CDS 100% 0.495 0.396 N BBS9 n/a
4 TRCN0000165680 GCTATTCTGGAAGCGGCATTT pLKO.1 2460 CDS 100% 10.800 7.560 N BBS9 n/a
5 TRCN0000158544 CCATTAGAATTGACTTGTGAT pLKO.1 1617 CDS 100% 4.950 3.465 N BBS9 n/a
6 TRCN0000166627 CCCGTACAGATTCCTTCCTTA pLKO.1 790 CDS 100% 4.950 3.465 N BBS9 n/a
7 TRCN0000159211 GCATGATTTAAAGGGAGTGAT pLKO.1 1241 CDS 100% 4.950 3.465 N BBS9 n/a
8 TRCN0000162318 CCTGCAATATGACCTATGGAT pLKO.1 631 CDS 100% 3.000 2.100 N BBS9 n/a
9 TRCN0000162127 CAAAGACACAAGCCAACTGAA pLKO.1 2618 CDS 100% 4.950 2.970 N BBS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15790 pDONR223 0% 33.9% 32.5% None (many diffs) n/a
2 ccsbBroad304_15790 pLX_304 0% 33.9% 32.5% V5 (many diffs) n/a
3 TRCN0000470394 TTGAGGGTCCCGTGCTGCTTATGC pLX_317 55.5% 33.9% 32.5% V5 (many diffs) n/a
Download CSV