Transcript: Human XM_017012084.2

PREDICTED: Homo sapiens sorting nexin 8 (SNX8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX8 (29886)
Length:
4846
CDS:
322..1560

Additional Resources:

NCBI RefSeq record:
XM_017012084.2
NBCI Gene record:
SNX8 (29886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153978 CTGATCCGGAACATCTACAAT pLKO.1 832 CDS 100% 5.625 7.875 N SNX8 n/a
2 TRCN0000343026 CTGATCCGGAACATCTACAAT pLKO_005 832 CDS 100% 5.625 7.875 N SNX8 n/a
3 TRCN0000157291 CTCATATTCGGGAAGGAGCTA pLKO.1 922 CDS 100% 2.640 3.696 N SNX8 n/a
4 TRCN0000158119 CTTCGTCAACTCTCAGATCCA pLKO.1 1413 CDS 100% 2.640 3.696 N SNX8 n/a
5 TRCN0000343028 CTTCGTCAACTCTCAGATCCA pLKO_005 1413 CDS 100% 2.640 3.696 N SNX8 n/a
6 TRCN0000157548 GCTAAGTGCAATAGGGTCTGA pLKO.1 939 CDS 100% 2.640 3.696 N SNX8 n/a
7 TRCN0000343027 GCTAAGTGCAATAGGGTCTGA pLKO_005 939 CDS 100% 2.640 3.696 N SNX8 n/a
8 TRCN0000153495 CGGATGTGCAGAACAAGTTAA pLKO.1 701 CDS 100% 13.200 9.240 N SNX8 n/a
9 TRCN0000342961 CGGATGTGCAGAACAAGTTAA pLKO_005 701 CDS 100% 13.200 9.240 N SNX8 n/a
10 TRCN0000156955 GCACAAGTACAGCCTGATGAA pLKO.1 1200 CDS 100% 4.950 3.465 N SNX8 n/a
11 TRCN0000151477 CAGAACAAGTTAAAGGAGTCA pLKO.1 709 CDS 100% 2.640 1.848 N SNX8 n/a
12 TRCN0000157696 CAGACGGTACAATGACTTCGT pLKO.1 483 CDS 100% 2.640 1.848 N SNX8 n/a
13 TRCN0000157806 CTTCCTGAAGCATGTGGAGTA pLKO.1 426 CDS 100% 4.050 2.430 N SNX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08130 pDONR223 100% 88.4% 88.6% None 0_1ins159;570A>G;969T>C n/a
2 ccsbBroad304_08130 pLX_304 0% 88.4% 88.6% V5 0_1ins159;570A>G;969T>C n/a
3 TRCN0000475084 TGCTTGTGAGTACACCCCTGTATA pLX_317 20.5% 88.4% 88.6% V5 0_1ins159;570A>G;969T>C n/a
Download CSV