Transcript: Human XM_017012328.1

PREDICTED: Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (PIK3CG), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3CG (5294)
Length:
3341
CDS:
144..3239

Additional Resources:

NCBI RefSeq record:
XM_017012328.1
NBCI Gene record:
PIK3CG (5294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149186 GAGAATACGTCCTCCACATG pXPR_003 TGG 1449 47% 2 0.5238 PIK3CG PIK3CG 76334
2 BRDN0001147429 ACTTAACCCTCTCACAGCAG pXPR_003 AGG 1705 55% 2 0.2337 PIK3CG PIK3CG 76333
3 BRDN0001149132 TTGCCTCTACAAAAACTGTG pXPR_003 AGG 1139 37% 2 0.0798 PIK3CG PIK3CG 76335
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430313 TACGAATCATGGAGTCTATTT pLKO_005 2686 CDS 100% 13.200 18.480 N PIK3CG n/a
2 TRCN0000033282 CGGGCACATTCTTGGGAATTA pLKO.1 3038 CDS 100% 13.200 10.560 N PIK3CG n/a
3 TRCN0000232402 GACGTCAGTTCCCAAGTTATT pLKO_005 2415 CDS 100% 13.200 10.560 N Pik3cg n/a
4 TRCN0000419619 AGCATATCCTAAGCTATTTAG pLKO_005 1904 CDS 100% 13.200 9.240 N PIK3CG n/a
5 TRCN0000361703 CAAGATCAGAGGCATTGATAT pLKO_005 1232 CDS 100% 13.200 9.240 N Pik3cg n/a
6 TRCN0000033281 GCCCTATCAAATGAAACAATT pLKO.1 2607 CDS 100% 13.200 9.240 N PIK3CG n/a
7 TRCN0000421875 GTGAAAGACGCCACGACAATT pLKO_005 2787 CDS 100% 13.200 9.240 N PIK3CG n/a
8 TRCN0000199330 CTCCAGATCTACTGCGGTAAA pLKO.1 1434 CDS 100% 10.800 7.560 N PIK3CG n/a
9 TRCN0000196449 GACTGAATCTTTGGATCTATG pLKO.1 2711 CDS 100% 10.800 7.560 N PIK3CG n/a
10 TRCN0000033279 GCAACCTTTGTTCTTGGAATA pLKO.1 2955 CDS 100% 10.800 7.560 N PIK3CG n/a
11 TRCN0000033280 GCAGAGCTTCTTCACCAAGAT pLKO.1 878 CDS 100% 4.950 3.465 N PIK3CG n/a
12 TRCN0000033283 CCTGTGGAAGAAGATTGCCAA pLKO.1 773 CDS 100% 2.640 1.584 N PIK3CG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14762 pDONR223 0% 92.7% 92% None (many diffs) n/a
2 ccsbBroad304_14762 pLX_304 0% 92.7% 92% V5 (many diffs) n/a
3 TRCN0000480523 TACTATCAGTCTAGTTATCATTTA pLX_317 12.4% 92.7% 92% V5 (many diffs) n/a
4 ccsbBroadEn_06727 pDONR223 100% 92.6% 91.9% None (many diffs) n/a
5 ccsbBroad304_06727 pLX_304 0% 92.6% 91.9% V5 (many diffs) n/a
6 TRCN0000481299 CCCACTCTGTAACCGTTGCGGCCC pLX_317 13.1% 92.6% 91.9% V5 (many diffs) n/a
Download CSV