Transcript: Human XM_017012364.2

PREDICTED: Homo sapiens ring finger protein 216 (RNF216), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF216 (54476)
Length:
2414
CDS:
251..2413

Additional Resources:

NCBI RefSeq record:
XM_017012364.2
NBCI Gene record:
RNF216 (54476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272644 GAGGATGACTACGGTGAATTT pLKO_005 632 CDS 100% 13.200 9.240 N RNF216 n/a
2 TRCN0000010789 ACACTATGCAATCACCCGAAA pLKO.1 1618 CDS 100% 4.050 2.025 Y RNF216 n/a
3 TRCN0000272691 ACACTATGCAATCACCCGAAA pLKO_005 1618 CDS 100% 4.050 2.025 Y RNF216 n/a
4 TRCN0000003466 GACACTATGCAATCACCCGAA pLKO.1 1617 CDS 100% 2.160 1.080 Y RNF216 n/a
5 TRCN0000040568 GCTCACTTGTTCTGCAAAGAA pLKO.1 2018 CDS 100% 5.625 3.375 N Rnf216 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10647 pDONR223 100% 6.9% 5.2% None (many diffs) n/a
2 ccsbBroad304_10647 pLX_304 0% 6.9% 5.2% V5 (many diffs) n/a
3 TRCN0000475787 AGGGTTGCTCTCTGCCTCCACAGC pLX_317 100% 6.9% 5.2% V5 (many diffs) n/a
Download CSV