Transcript: Human XM_017012472.1

PREDICTED: Homo sapiens striatin interacting protein 2 (STRIP2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRIP2 (57464)
Length:
6580
CDS:
2412..4010

Additional Resources:

NCBI RefSeq record:
XM_017012472.1
NBCI Gene record:
STRIP2 (57464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446483 TGTACAGCCTTCCGCAGTATA pLKO_005 3034 CDS 100% 13.200 18.480 N STRIP2 n/a
2 TRCN0000432779 TTAAATCGGCACCAATCTTAA pLKO_005 3568 CDS 100% 13.200 18.480 N STRIP2 n/a
3 TRCN0000145355 GCAGAATCACATACTTCTCAA pLKO.1 5108 3UTR 100% 4.950 6.930 N STRIP2 n/a
4 TRCN0000142014 GATAACTGCTTGCAGAGCGTA pLKO.1 3876 CDS 100% 2.640 3.696 N STRIP2 n/a
5 TRCN0000142787 CCCGTTTATTGCTAGCAGTTT pLKO.1 4978 3UTR 100% 4.950 3.960 N STRIP2 n/a
6 TRCN0000412588 GGGATCCTGAATCACAATAAA pLKO_005 4148 3UTR 100% 15.000 10.500 N STRIP2 n/a
7 TRCN0000416097 CCCTAAAGCAGCACAAGTATA pLKO_005 2899 CDS 100% 13.200 9.240 N STRIP2 n/a
8 TRCN0000122269 CCGAGTTGTCAGAATTGTATA pLKO.1 228 5UTR 100% 13.200 9.240 N STRIP2 n/a
9 TRCN0000215324 CTAAGACAGACTCTATCAATA pLKO.1 3103 CDS 100% 13.200 9.240 N Strip2 n/a
10 TRCN0000264784 CTAAGACAGACTCTATCAATA pLKO_005 3103 CDS 100% 13.200 9.240 N Strip2 n/a
11 TRCN0000144802 GCTGCAACTTTATGTCCTAAA pLKO.1 3617 CDS 100% 10.800 7.560 N STRIP2 n/a
12 TRCN0000144412 CTACAATGAAAGGGATCTCTT pLKO.1 2576 CDS 100% 4.950 3.465 N STRIP2 n/a
13 TRCN0000143653 CTGGAGTTTGAGTATGGAGAT pLKO.1 191 5UTR 100% 4.050 2.835 N STRIP2 n/a
14 TRCN0000142736 CCAAGCAGAAGAATGTACCTT pLKO.1 3785 CDS 100% 3.000 2.100 N STRIP2 n/a
15 TRCN0000143377 GAATGTGATTCAGAGGTCGAT pLKO.1 461 5UTR 100% 2.640 1.848 N STRIP2 n/a
16 TRCN0000121875 GACATCTACAATGAAAGGGAT pLKO.1 2571 CDS 100% 2.640 1.848 N STRIP2 n/a
17 TRCN0000141806 GAGTTGGAAGAAGATGCCCAA pLKO.1 335 5UTR 100% 2.160 1.512 N STRIP2 n/a
18 TRCN0000144910 GCTAAGACAGACTCTATCAAT pLKO.1 3102 CDS 100% 5.625 3.375 N STRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03824 pDONR223 100% 53.2% 49.8% None (many diffs) n/a
2 ccsbBroad304_03824 pLX_304 0% 53.2% 49.8% V5 (many diffs) n/a
Download CSV