Transcript: Human XM_017012649.2

PREDICTED: Homo sapiens cadherin like and PC-esterase domain containing 1 (CPED1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPED1 (79974)
Length:
3973
CDS:
806..3136

Additional Resources:

NCBI RefSeq record:
XM_017012649.2
NBCI Gene record:
CPED1 (79974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415332 CTTTCGAGCCGAAGATCTATC pLKO_005 1591 CDS 100% 10.800 15.120 N CPED1 n/a
2 TRCN0000137513 GCCTTAGTTGTTCGGACAACA pLKO.1 2997 CDS 100% 0.495 0.693 N CPED1 n/a
3 TRCN0000419687 GGATCAGGGAATGCAATTAAA pLKO_005 1456 CDS 100% 15.000 10.500 N CPED1 n/a
4 TRCN0000134586 GAAACCAGAAAGGTCAAAGAA pLKO.1 1043 CDS 100% 5.625 3.938 N CPED1 n/a
5 TRCN0000134567 GAATCAATGGAGACACACTTT pLKO.1 1061 CDS 100% 4.950 3.465 N CPED1 n/a
6 TRCN0000136490 CCTGTCTTCTAAGAAAGCAGA pLKO.1 1270 CDS 100% 2.640 1.848 N CPED1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12652 pDONR223 100% 70.5% 70.3% None (many diffs) n/a
2 ccsbBroad304_12652 pLX_304 0% 70.5% 70.3% V5 (many diffs) n/a
3 TRCN0000468430 GATTCAACAATCGACCCGTCACTT pLX_317 25.5% 70.5% 70.3% V5 (many diffs) n/a
Download CSV