Transcript: Human XM_017012820.1

PREDICTED: Homo sapiens dedicator of cytokinesis 4 (DOCK4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK4 (9732)
Length:
7626
CDS:
100..6093

Additional Resources:

NCBI RefSeq record:
XM_017012820.1
NBCI Gene record:
DOCK4 (9732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039731 GCTTCGAGTTTCGGCATTGTT pLKO.1 1649 CDS 100% 5.625 7.875 N DOCK4 n/a
2 TRCN0000039729 CGGGTAACAATGGGTTGTGAA pLKO.1 3313 CDS 100% 4.950 3.960 N DOCK4 n/a
3 TRCN0000039728 CCCAAATATCAAGGGTATATT pLKO.1 342 CDS 100% 1.500 1.200 N DOCK4 n/a
4 TRCN0000295903 CTAACACAGTGGTCCTTATTT pLKO_005 6497 3UTR 100% 15.000 10.500 N DOCK4 n/a
5 TRCN0000295904 CGTATCCTTAGCAACGTATTT pLKO_005 2749 CDS 100% 13.200 9.240 N DOCK4 n/a
6 TRCN0000039732 GCACTTCGTAAGAACTTCTTA pLKO.1 3157 CDS 100% 5.625 3.938 N DOCK4 n/a
7 TRCN0000288692 GCACTTCGTAAGAACTTCTTA pLKO_005 3157 CDS 100% 5.625 3.938 N DOCK4 n/a
8 TRCN0000039730 GCCGTGCATGAGAAGTTTGTA pLKO.1 4867 CDS 100% 5.625 3.938 N DOCK4 n/a
9 TRCN0000288628 GCCGTGCATGAGAAGTTTGTA pLKO_005 4867 CDS 100% 5.625 3.938 N DOCK4 n/a
10 TRCN0000009881 GAAGTGTGATGGCTGGTACAG pLKO.1 303 CDS 100% 4.050 2.835 N DOCK4 n/a
11 TRCN0000010481 GAAGGAAGCCAAGAACATGTC pLKO.1 5511 CDS 100% 4.050 2.430 N DOCK4 n/a
12 TRCN0000295902 GAAGGAAGCCAAGAACATGTC pLKO_005 5511 CDS 100% 4.050 2.430 N DOCK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11410 pDONR223 100% 54.6% 53% None (many diffs) n/a
2 ccsbBroad304_11410 pLX_304 0% 54.6% 53% V5 (many diffs) n/a
3 TRCN0000480447 AGACCCGTCTGTCAAACGTTTCAC pLX_317 7.5% 54.6% 53% V5 (many diffs) n/a
Download CSV