Transcript: Human XM_017012947.1

PREDICTED: Homo sapiens nucleophosmin/nucleoplasmin 2 (NPM2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPM2 (10361)
Length:
1637
CDS:
668..1411

Additional Resources:

NCBI RefSeq record:
XM_017012947.1
NBCI Gene record:
NPM2 (10361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154167 CGTTATGAAGCATCAGACCTA pLKO.1 1124 CDS 100% 2.640 3.696 N NPM2 n/a
2 TRCN0000150854 GTTATGAAGCATCAGACCTAA pLKO.1 1125 CDS 100% 4.950 3.465 N NPM2 n/a
3 TRCN0000156884 GAGGAAATAAGAGCCAGCGTT pLKO.1 1322 CDS 100% 2.640 1.848 N NPM2 n/a
4 TRCN0000153371 GATATATCTCTGGAGGAGCAA pLKO.1 1220 CDS 100% 2.640 1.848 N NPM2 n/a
5 TRCN0000153370 GAGGATGAGGATGCAGATATA pLKO.1 1205 CDS 100% 13.200 7.920 N NPM2 n/a
6 TRCN0000156844 GATGAGGATGAGGATGCAGAT pLKO.1 1202 CDS 100% 4.050 2.430 N NPM2 n/a
7 TRCN0000153398 GAAGAGGAAGATGATGAGGAT pLKO.1 1190 CDS 100% 2.640 1.584 N NPM2 n/a
8 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 1184 CDS 100% 4.950 2.475 Y NPM2 n/a
9 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 1181 CDS 100% 4.950 2.475 Y NPM2 n/a
10 TRCN0000158207 CAGGCTGTTGCTTCATACGAT pLKO.1 1018 CDS 100% 3.000 2.400 N NPM2 n/a
11 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1179 CDS 100% 4.950 2.475 Y Adam32 n/a
12 TRCN0000420925 GATGATGAGGATGAGGATGAT pLKO_005 1199 CDS 100% 4.950 2.475 Y TAF7L n/a
13 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 57 5UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.