Transcript: Human XM_017012999.2

PREDICTED: Homo sapiens protein tyrosine phosphatase 4A3 (PTP4A3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTP4A3 (11156)
Length:
2728
CDS:
944..1318

Additional Resources:

NCBI RefSeq record:
XM_017012999.2
NBCI Gene record:
PTP4A3 (11156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355596 CAAGACCCGGTGCTGCGTTAT pLKO_005 1294 CDS 100% 3.600 5.040 N PTP4A3 n/a
2 TRCN0000010661 ACCGTTGTGGACTGGCCGTTT pLKO.1 1061 CDS 100% 1.350 1.890 N PTP4A3 n/a
3 TRCN0000355595 CAAACAGAGGCTGCGGTTCAA pLKO_005 1258 CDS 100% 4.950 3.960 N PTP4A3 n/a
4 TRCN0000355597 GTGTGTGAAGTGACCTATGAC pLKO_005 1013 CDS 100% 4.950 3.960 N PTP4A3 n/a
5 TRCN0000220145 TCTCGGCACCTTAAATTATTA pLKO.1 1718 3UTR 100% 15.000 10.500 N PTP4A3 n/a
6 TRCN0000368291 AGCTCACCTACCTGGAGAAAT pLKO_005 1230 CDS 100% 13.200 9.240 N PTP4A3 n/a
7 TRCN0000010662 GCGTGTGTGTGAAGTGACCTA pLKO.1 1009 CDS 100% 2.640 1.848 N PTP4A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02632 pDONR223 100% 83.7% 83.7% None 30_31ins72 n/a
2 ccsbBroad304_02632 pLX_304 0% 83.7% 83.7% V5 30_31ins72 n/a
3 TRCN0000474068 CCAAGAGTACGCCGTGGATCCAGG pLX_317 100% 83.7% 83.7% V5 30_31ins72 n/a
Download CSV