Transcript: Human XM_017013140.1

PREDICTED: Homo sapiens minichromosome maintenance domain containing 2 (MCMDC2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCMDC2 (157777)
Length:
1884
CDS:
578..1828

Additional Resources:

NCBI RefSeq record:
XM_017013140.1
NBCI Gene record:
MCMDC2 (157777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149391 GCTTTATAGGAGACTTGGCTT pLKO.1 993 CDS 100% 2.640 3.696 N MCMDC2 n/a
2 TRCN0000419296 CAAGTGATACTCTACTCATAG pLKO_005 900 CDS 100% 10.800 8.640 N MCMDC2 n/a
3 TRCN0000413261 AGAATGACCCATGGCTATTAT pLKO_005 1448 CDS 100% 15.000 10.500 N MCMDC2 n/a
4 TRCN0000150099 CTCTGTTTGTTGATGAGTCTA pLKO.1 821 CDS 100% 4.950 3.465 N MCMDC2 n/a
5 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1726 CDS 100% 4.950 2.475 Y ERN2 n/a
6 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1726 CDS 100% 4.950 2.475 Y P3H4 n/a
7 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1726 CDS 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 47.1% 47.2% None 0_1ins711;344_345ins81;963_1248delinsG n/a
2 ccsbBroad304_13302 pLX_304 0% 47.1% 47.2% V5 0_1ins711;344_345ins81;963_1248delinsG n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 47.1% 47.2% V5 0_1ins711;344_345ins81;963_1248delinsG n/a
Download CSV