Transcript: Human XM_017013188.1

PREDICTED: Homo sapiens ADAM metallopeptidase domain 32 (ADAM32), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM32 (203102)
Length:
1638
CDS:
120..1520

Additional Resources:

NCBI RefSeq record:
XM_017013188.1
NBCI Gene record:
ADAM32 (203102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052341 GCACGTTGTGAGAGTGTATTT pLKO.1 654 CDS 100% 13.200 18.480 N ADAM32 n/a
2 TRCN0000052338 GCGAATCTAAATCGGAAGGTA pLKO.1 1315 CDS 100% 3.000 4.200 N ADAM32 n/a
3 TRCN0000052340 GCATAACTGTAGACTACAAAT pLKO.1 892 CDS 100% 13.200 10.560 N ADAM32 n/a
4 TRCN0000052342 GCAGCAGTCAAGCTGATACTA pLKO.1 1411 CDS 100% 5.625 3.938 N ADAM32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05208 pDONR223 100% 59.1% 59% None 0_1ins963;437C>G n/a
2 ccsbBroad304_05208 pLX_304 0% 59.1% 59% V5 0_1ins963;437C>G n/a
3 TRCN0000469709 TGGGGTACGGAGATATGGTCGTCT pLX_317 19.8% 59.1% 59% V5 0_1ins963;437C>G n/a
4 ccsbBroadEn_16122 pDONR223 0% 59.1% 59% None 0_1ins963;437C>G n/a
5 ccsbBroad304_16122 pLX_304 0% 59.1% 59% V5 0_1ins963;437C>G n/a
6 TRCN0000473039 CAAGTTCAAGTTGATTCGAACCAA pLX_317 16.8% 59.1% 59% V5 0_1ins963;437C>G n/a
Download CSV