Transcript: Human XM_017013267.2

PREDICTED: Homo sapiens translocation associated membrane protein 1 (TRAM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAM1 (23471)
Length:
2908
CDS:
578..1414

Additional Resources:

NCBI RefSeq record:
XM_017013267.2
NBCI Gene record:
TRAM1 (23471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304158 TGTTCTAAGAAGGCCATATTT pLKO_005 1780 3UTR 100% 15.000 10.500 N TRAM1 n/a
2 TRCN0000304157 TCGCTGTTCTGGCATCCATTT pLKO_005 1182 CDS 100% 10.800 7.560 N TRAM1 n/a
3 TRCN0000062941 GAAGAAACCAACAGTAACTAA pLKO.1 1294 CDS 100% 5.625 3.938 N TRAM1 n/a
4 TRCN0000300865 GAAGAAACCAACAGTAACTAA pLKO_005 1294 CDS 100% 5.625 3.938 N TRAM1 n/a
5 TRCN0000062940 ACTGGAAACTTCAATGTGTTA pLKO.1 1151 CDS 100% 4.950 3.465 N TRAM1 n/a
6 TRCN0000300789 ACTGGAAACTTCAATGTGTTA pLKO_005 1151 CDS 100% 4.950 3.465 N TRAM1 n/a
7 TRCN0000062942 CAACTATCTTATGGAGGGCTT pLKO.1 735 CDS 100% 2.160 1.512 N TRAM1 n/a
8 TRCN0000300788 CAACTATCTTATGGAGGGCTT pLKO_005 735 CDS 100% 2.160 1.512 N TRAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02773 pDONR223 100% 74.3% 72.4% None 0_1ins166;21_22ins122 n/a
2 ccsbBroad304_02773 pLX_304 0% 74.3% 72.4% V5 0_1ins166;21_22ins122 n/a
3 TRCN0000472143 CGCTTCGCCCCGGCTCTCTCGGCT pLX_317 41.2% 74.3% 72.4% V5 0_1ins166;21_22ins122 n/a
Download CSV