Transcript: Human XM_017013615.1

PREDICTED: Homo sapiens syntabulin (SYBU), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYBU (55638)
Length:
2778
CDS:
414..2048

Additional Resources:

NCBI RefSeq record:
XM_017013615.1
NBCI Gene record:
SYBU (55638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128052 GCAGTATTTGACTCCACTGCA pLKO.1 851 CDS 100% 0.264 0.370 N SYBU n/a
2 TRCN0000276263 GCAGTATTTGACTCCACTGCA pLKO_005 851 CDS 100% 0.264 0.370 N SYBU n/a
3 TRCN0000381595 TTCCGCTCCTGAGGTCCATAT pLKO_005 527 CDS 100% 10.800 8.640 N SYBU n/a
4 TRCN0000276261 CATTCAGTCCTCTCGATATAA pLKO_005 431 CDS 100% 15.000 10.500 N SYBU n/a
5 TRCN0000276262 GGAGACCTGGTTCCAGTAAAT pLKO_005 2229 3UTR 100% 13.200 9.240 N SYBU n/a
6 TRCN0000130355 GCAGCTTGGCTGATAAAGATA pLKO.1 1093 CDS 100% 5.625 3.938 N SYBU n/a
7 TRCN0000285504 GCAGCTTGGCTGATAAAGATA pLKO_005 1093 CDS 100% 5.625 3.938 N SYBU n/a
8 TRCN0000127887 CCTACAAAGGAAGCGACTGTA pLKO.1 757 CDS 100% 4.950 3.465 N SYBU n/a
9 TRCN0000127654 CCTCTTGACACAATGGCAGAT pLKO.1 1272 CDS 100% 4.050 2.835 N SYBU n/a
10 TRCN0000191565 GCTGATAAAGATAAAGGCATT pLKO.1 1101 CDS 100% 4.050 2.835 N Sybu n/a
11 TRCN0000129065 GAAAGTGAAATCGTGGAGCTT pLKO.1 942 CDS 100% 2.640 1.848 N SYBU n/a
12 TRCN0000281986 GAAAGTGAAATCGTGGAGCTT pLKO_005 942 CDS 100% 2.640 1.848 N SYBU n/a
13 TRCN0000130889 GAAGTGATGAAGGCTTCACCA pLKO.1 373 5UTR 100% 2.640 1.848 N SYBU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12239 pDONR223 100% 84% 84% None 1_261del n/a
2 ccsbBroad304_12239 pLX_304 0% 84% 84% V5 1_261del n/a
3 TRCN0000470079 TTGGAGCGAACGATTCTTCTTGTT pLX_317 32.9% 84% 84% V5 1_261del n/a
Download CSV