Transcript: Human XM_017013956.2

PREDICTED: Homo sapiens myotubularin related protein 7 (MTMR7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTMR7 (9108)
Length:
5645
CDS:
793..1911

Additional Resources:

NCBI RefSeq record:
XM_017013956.2
NBCI Gene record:
MTMR7 (9108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359863 GATGGGCCTCCCTAATCATTA pLKO_005 475 5UTR 100% 13.200 18.480 N MTMR7 n/a
2 TRCN0000363237 TTCCGGAGTAGACGGCGATTT pLKO_005 605 5UTR 100% 10.800 15.120 N MTMR7 n/a
3 TRCN0000146728 CCTTTGGAGTTCCAAAGTAAA pLKO.1 1918 3UTR 100% 1.320 1.056 N MTMR7 n/a
4 TRCN0000149319 GCTGAGCAGTTCCCAAATTAA pLKO.1 3472 3UTR 100% 15.000 10.500 N MTMR7 n/a
5 TRCN0000363351 TGAAGGGCTTCATGGTATTAA pLKO_005 1016 CDS 100% 15.000 10.500 N MTMR7 n/a
6 TRCN0000148562 CCAGGATTACAGTGGGAATAT pLKO.1 1665 CDS 100% 13.200 9.240 N MTMR7 n/a
7 TRCN0000146753 CCAGTGAAATATGAGGAGTTA pLKO.1 368 5UTR 100% 4.950 3.465 N MTMR7 n/a
8 TRCN0000149466 GATTCTGATGAAGCCGTGTTT pLKO.1 1879 CDS 100% 4.950 3.465 N MTMR7 n/a
9 TRCN0000146752 CCAGTTAAATTGCACTAAGGT pLKO.1 1572 CDS 100% 3.000 2.100 N MTMR7 n/a
10 TRCN0000148782 CCAGGAAGTGACTTCGTTTAT pLKO.1 752 5UTR 100% 13.200 7.920 N MTMR7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07361 pDONR223 100% 56.3% 56.2% None 1_1delAins865 n/a
2 ccsbBroad304_07361 pLX_304 0% 56.3% 56.2% V5 1_1delAins865 n/a
3 TRCN0000465949 GCTCGAGCGTCCCAGCTTCGCACC pLX_317 14% 56.3% 56.2% V5 1_1delAins865 n/a
4 ccsbBroadEn_14929 pDONR223 92.3% 56.3% 56.2% None 1_1delAins865 n/a
5 ccsbBroad304_14929 pLX_304 0% 56.3% 56.2% V5 1_1delAins865 n/a
6 ccsbBroadEn_15656 pDONR223 0% 56.3% 56.2% None 1_1delAins865 n/a
7 ccsbBroad304_15656 pLX_304 0% 56.3% 56.2% V5 1_1delAins865 n/a
8 TRCN0000465507 CTAAAGTGTTCGTGTCGTCAGGAT pLX_317 14% 56.2% 56.2% V5 1_1delAins865;1104G>T n/a
Download CSV