Transcript: Human XM_017013968.2

PREDICTED: Homo sapiens metadherin (MTDH), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTDH (92140)
Length:
5646
CDS:
536..2044

Additional Resources:

NCBI RefSeq record:
XM_017013968.2
NBCI Gene record:
MTDH (92140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155813 CGTGATAAGGTGCTGACTGAT pLKO.1 1154 CDS 100% 4.950 6.930 N MTDH n/a
2 TRCN0000322872 CGTGATAAGGTGCTGACTGAT pLKO_005 1154 CDS 100% 4.950 6.930 N MTDH n/a
3 TRCN0000152993 GATTCAACTATCCCTGGGATA pLKO.1 1187 CDS 100% 4.050 5.670 N MTDH n/a
4 TRCN0000153105 GCAACTTACAACCGCATCATT pLKO.1 1234 CDS 100% 5.625 3.938 N MTDH n/a
5 TRCN0000152120 CCAAGTCAAATACCAAGCAAA pLKO.1 1932 CDS 100% 4.950 3.465 N MTDH n/a
6 TRCN0000322874 CCAAGTCAAATACCAAGCAAA pLKO_005 1932 CDS 100% 4.950 3.465 N MTDH n/a
7 TRCN0000152352 CCAATACTACAAGAGACAGAT pLKO.1 1907 CDS 100% 4.950 3.465 N MTDH n/a
8 TRCN0000322947 CCAATACTACAAGAGACAGAT pLKO_005 1907 CDS 100% 4.950 3.465 N MTDH n/a
9 TRCN0000151467 CGAGGAATAAAGGATTCTGAT pLKO.1 2367 3UTR 100% 4.950 3.465 N MTDH n/a
10 TRCN0000322949 CGAGGAATAAAGGATTCTGAT pLKO_005 2367 3UTR 100% 4.950 3.465 N MTDH n/a
11 TRCN0000151559 GCCTTATTAATGGACAGCTTT pLKO.1 3531 3UTR 100% 4.950 3.465 N MTDH n/a
12 TRCN0000156091 CCGCCAATACTACAAGAGACA pLKO.1 1904 CDS 100% 2.640 1.848 N MTDH n/a
13 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4611 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09330 pDONR223 100% 86.1% 85.7% None (many diffs) n/a
2 ccsbBroad304_09330 pLX_304 0% 86.1% 85.7% V5 (many diffs) n/a
3 TRCN0000478940 ATGAGACCATCGGCACTAGAAAAC pLX_317 23.6% 86.1% 85.7% V5 (many diffs) n/a
Download CSV