Transcript: Human XM_017014294.1

PREDICTED: Homo sapiens ring finger protein 38 (RNF38), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF38 (152006)
Length:
5014
CDS:
326..1660

Additional Resources:

NCBI RefSeq record:
XM_017014294.1
NBCI Gene record:
RNF38 (152006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431291 CAAATCGTACTTGCCCAATTT pLKO_005 1599 CDS 100% 13.200 18.480 N RNF38 n/a
2 TRCN0000435934 GATCGTCTGTCTCGACATAAT pLKO_005 500 CDS 100% 13.200 18.480 N RNF38 n/a
3 TRCN0000426924 TGAGTCAAGGCAGCTACTTAG pLKO_005 1522 CDS 100% 10.800 15.120 N RNF38 n/a
4 TRCN0000004622 AGTACCTTATCCTCCATTTAT pLKO.1 1180 CDS 100% 15.000 10.500 N RNF38 n/a
5 TRCN0000424373 CAACCTAAGAAGCACAAATTT pLKO_005 1662 3UTR 100% 15.000 10.500 N RNF38 n/a
6 TRCN0000427191 GACTGACTAAAGCAGATATTG pLKO_005 1422 CDS 100% 13.200 9.240 N RNF38 n/a
7 TRCN0000429531 GCGTATGACTGTTGGTGATAA pLKO_005 2072 3UTR 100% 13.200 9.240 N RNF38 n/a
8 TRCN0000311188 CAGCACTTACCAGTACCATAT pLKO_005 872 CDS 100% 10.800 7.560 N Rnf38 n/a
9 TRCN0000413006 TACGCACAGCAGCAAGCAATA pLKO_005 557 CDS 100% 10.800 7.560 N RNF38 n/a
10 TRCN0000004619 CCTTATTTCTAGTGATCCATT pLKO.1 907 CDS 100% 4.950 3.465 N RNF38 n/a
11 TRCN0000040999 CGACATAATTCCATTAGTCAA pLKO.1 512 CDS 100% 4.950 3.465 N Rnf38 n/a
12 TRCN0000302739 CGACATAATTCCATTAGTCAA pLKO_005 512 CDS 100% 4.950 3.465 N Rnf38 n/a
13 TRCN0000004623 CTTCCTTCTTATCGGTTCAAT pLKO.1 1448 CDS 100% 5.625 3.375 N RNF38 n/a
14 TRCN0000004620 CAATGTATAATCTGGTGTGTT pLKO.1 2208 3UTR 100% 4.950 2.970 N RNF38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05061 pDONR223 100% 94.1% 84.3% None (many diffs) n/a
2 ccsbBroad304_05061 pLX_304 0% 94.1% 84.3% V5 (many diffs) n/a
3 TRCN0000480062 TGCATCGCAGAGCTACCTAGCGTC pLX_317 27.1% 94.1% 84.3% V5 (many diffs) n/a
Download CSV