Transcript: Human XM_017014297.1

PREDICTED: Homo sapiens ring finger protein 38 (RNF38), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF38 (152006)
Length:
4690
CDS:
128..1336

Additional Resources:

NCBI RefSeq record:
XM_017014297.1
NBCI Gene record:
RNF38 (152006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431291 CAAATCGTACTTGCCCAATTT pLKO_005 1275 CDS 100% 13.200 18.480 N RNF38 n/a
2 TRCN0000435934 GATCGTCTGTCTCGACATAAT pLKO_005 176 CDS 100% 13.200 18.480 N RNF38 n/a
3 TRCN0000426924 TGAGTCAAGGCAGCTACTTAG pLKO_005 1198 CDS 100% 10.800 15.120 N RNF38 n/a
4 TRCN0000004622 AGTACCTTATCCTCCATTTAT pLKO.1 856 CDS 100% 15.000 10.500 N RNF38 n/a
5 TRCN0000424373 CAACCTAAGAAGCACAAATTT pLKO_005 1338 3UTR 100% 15.000 10.500 N RNF38 n/a
6 TRCN0000427191 GACTGACTAAAGCAGATATTG pLKO_005 1098 CDS 100% 13.200 9.240 N RNF38 n/a
7 TRCN0000429531 GCGTATGACTGTTGGTGATAA pLKO_005 1748 3UTR 100% 13.200 9.240 N RNF38 n/a
8 TRCN0000311188 CAGCACTTACCAGTACCATAT pLKO_005 548 CDS 100% 10.800 7.560 N Rnf38 n/a
9 TRCN0000413006 TACGCACAGCAGCAAGCAATA pLKO_005 233 CDS 100% 10.800 7.560 N RNF38 n/a
10 TRCN0000004619 CCTTATTTCTAGTGATCCATT pLKO.1 583 CDS 100% 4.950 3.465 N RNF38 n/a
11 TRCN0000040999 CGACATAATTCCATTAGTCAA pLKO.1 188 CDS 100% 4.950 3.465 N Rnf38 n/a
12 TRCN0000302739 CGACATAATTCCATTAGTCAA pLKO_005 188 CDS 100% 4.950 3.465 N Rnf38 n/a
13 TRCN0000004623 CTTCCTTCTTATCGGTTCAAT pLKO.1 1124 CDS 100% 5.625 3.375 N RNF38 n/a
14 TRCN0000004620 CAATGTATAATCTGGTGTGTT pLKO.1 1884 3UTR 100% 4.950 2.970 N RNF38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05061 pDONR223 100% 92.6% 91.8% None (many diffs) n/a
2 ccsbBroad304_05061 pLX_304 0% 92.6% 91.8% V5 (many diffs) n/a
3 TRCN0000480062 TGCATCGCAGAGCTACCTAGCGTC pLX_317 27.1% 92.6% 91.8% V5 (many diffs) n/a
Download CSV