Transcript: Human XM_017014472.2

PREDICTED: Homo sapiens fukutin (FKTN), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FKTN (2218)
Length:
1985
CDS:
675..1955

Additional Resources:

NCBI RefSeq record:
XM_017014472.2
NBCI Gene record:
FKTN (2218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432583 AGTTACAGTTTGGTCGTTATC pLKO_005 1099 CDS 100% 10.800 15.120 N FKTN n/a
2 TRCN0000063763 GCGATCCACTTGGTAGTCTTT pLKO.1 996 CDS 100% 4.950 3.960 N FKTN n/a
3 TRCN0000063767 CCTTTGATACTGGAATTGATT pLKO.1 717 CDS 100% 5.625 3.938 N FKTN n/a
4 TRCN0000063765 GCTGTTTCAGTTGTACTACTA pLKO.1 427 5UTR 100% 4.950 3.465 N FKTN n/a
5 TRCN0000416772 GGTATCGACAATGCAACATTA pLKO_005 1402 CDS 100% 13.200 7.920 N FKTN n/a
6 TRCN0000063766 CCAATGCACTTTGTAGAAGAA pLKO.1 1191 CDS 100% 4.950 2.970 N FKTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00547 pDONR223 100% 73.8% 67.5% None (many diffs) n/a
2 ccsbBroad304_00547 pLX_304 0% 73.8% 67.5% V5 (many diffs) n/a
3 TRCN0000477168 TATCTTTCCCAATCGAGACGCCGT pLX_317 23.3% 73.8% 67.5% V5 (many diffs) n/a
Download CSV