Construct: ORF TRCN0000477168
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009312.1_s317c1
- Derived from:
- ccsbBroadEn_00547
- DNA Barcode:
- TATCTTTCCCAATCGAGACGCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FKTN (2218)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477168
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2218 | FKTN | fukutin | NM_001079802.1 | 100% | 100% | |
2 | human | 2218 | FKTN | fukutin | NM_001351496.2 | 100% | 100% | |
3 | human | 2218 | FKTN | fukutin | NM_006731.2 | 100% | 100% | |
4 | human | 2218 | FKTN | fukutin | XM_017014467.1 | 100% | 100% | |
5 | human | 2218 | FKTN | fukutin | XM_017014468.1 | 100% | 100% | |
6 | human | 2218 | FKTN | fukutin | XM_017014469.1 | 94.5% | 90.3% | (many diffs) |
7 | human | 2218 | FKTN | fukutin | XM_017014464.1 | 94.3% | 89.9% | (many diffs) |
8 | human | 2218 | FKTN | fukutin | XM_017014465.1 | 94.3% | 89.9% | (many diffs) |
9 | human | 2218 | FKTN | fukutin | XM_017014470.1 | 94.2% | 92.8% | (many diffs) |
10 | human | 2218 | FKTN | fukutin | NM_001198963.2 | 92.9% | 92.1% | (many diffs) |
11 | human | 2218 | FKTN | fukutin | NM_001351497.2 | 91.3% | 89.8% | (many diffs) |
12 | human | 2218 | FKTN | fukutin | XM_011518378.2 | 87.8% | 82.2% | (many diffs) |
13 | human | 2218 | FKTN | fukutin | XM_011518368.2 | 86.1% | 79.6% | (many diffs) |
14 | human | 2218 | FKTN | fukutin | XM_011518369.2 | 86.1% | 79.6% | (many diffs) |
15 | human | 2218 | FKTN | fukutin | XM_011518370.2 | 86.1% | 79.6% | (many diffs) |
16 | human | 2218 | FKTN | fukutin | XM_011518371.2 | 86.1% | 79.6% | (many diffs) |
17 | human | 2218 | FKTN | fukutin | XM_011518373.2 | 86.1% | 79.6% | (many diffs) |
18 | human | 2218 | FKTN | fukutin | XM_011518374.2 | 86.1% | 79.6% | (many diffs) |
19 | human | 2218 | FKTN | fukutin | XM_011518375.2 | 86.1% | 79.6% | (many diffs) |
20 | human | 2218 | FKTN | fukutin | XM_011518376.2 | 86.1% | 79.6% | (many diffs) |
21 | human | 2218 | FKTN | fukutin | XM_017014462.1 | 86.1% | 79.6% | (many diffs) |
22 | human | 2218 | FKTN | fukutin | XM_017014463.1 | 86.1% | 79.6% | (many diffs) |
23 | human | 2218 | FKTN | fukutin | NM_001351498.2 | 85.2% | 85.9% | 1173_1203del;1236_1237ins178 |
24 | human | 2218 | FKTN | fukutin | XM_011518379.2 | 78.3% | 70.5% | (many diffs) |
25 | human | 2218 | FKTN | fukutin | XM_011518381.3 | 73.8% | 67.5% | (many diffs) |
26 | human | 2218 | FKTN | fukutin | XM_017014472.2 | 73.8% | 67.5% | (many diffs) |
27 | human | 2218 | FKTN | fukutin | XM_017014473.2 | 73.8% | 67.5% | (many diffs) |
28 | human | 2218 | FKTN | fukutin | XR_001746244.2 | 71.8% | (many diffs) | |
29 | human | 2218 | FKTN | fukutin | NM_001351499.2 | 71.3% | 71.3% | 0_1ins396 |
30 | human | 2218 | FKTN | fukutin | NM_001351500.2 | 71.3% | 71.3% | 0_1ins396 |
31 | human | 2218 | FKTN | fukutin | NM_001351501.2 | 71.3% | 71.3% | 0_1ins396 |
32 | human | 2218 | FKTN | fukutin | NM_001351502.2 | 71.3% | 71.3% | 0_1ins396 |
33 | human | 2218 | FKTN | fukutin | XM_011518387.2 | 68.6% | 62.5% | (many diffs) |
34 | human | 2218 | FKTN | fukutin | XM_017014475.1 | 68.6% | 62.5% | (many diffs) |
35 | human | 2218 | FKTN | fukutin | XR_001746242.2 | 65.5% | (many diffs) | |
36 | human | 2218 | FKTN | fukutin | XR_001746243.2 | 60.1% | 1_364del;1537_1858del;1930_1931ins139 | |
37 | human | 2218 | FKTN | fukutin | XM_011518390.2 | 59.8% | 53.9% | (many diffs) |
38 | human | 2218 | FKTN | fukutin | XM_006717014.2 | 57.7% | 55.9% | (many diffs) |
39 | human | 2218 | FKTN | fukutin | XM_011518391.2 | 57.7% | 55.9% | (many diffs) |
40 | human | 2218 | FKTN | fukutin | XR_002956770.1 | 18.4% | 1_214del;1257_1284del;1626_7482del | |
41 | human | 2218 | FKTN | fukutin | NR_147214.2 | 18.3% | 1_123del;1296_1467del;1679_7535del | |
42 | human | 2218 | FKTN | fukutin | XR_001746245.1 | 18.1% | 1_214del;1387_1558del;1770_7626del | |
43 | human | 2218 | FKTN | fukutin | XR_001746248.1 | 15.8% | (many diffs) | |
44 | human | 2218 | FKTN | fukutin | NR_147213.2 | 14.6% | (many diffs) | |
45 | mouse | 246179 | Fktn | fukutin | NM_139309.4 | 87.5% | 89.8% | (many diffs) |
46 | mouse | 246179 | Fktn | fukutin | XM_006537941.3 | 80.7% | 82.8% | (many diffs) |
47 | mouse | 246179 | Fktn | fukutin | XM_017320228.1 | 80.7% | 82.8% | (many diffs) |
48 | mouse | 246179 | Fktn | fukutin | XM_006537942.3 | 75.4% | 77.6% | (many diffs) |
49 | mouse | 246179 | Fktn | fukutin | XM_017320229.1 | 75.4% | 77.6% | (many diffs) |
50 | mouse | 246179 | Fktn | fukutin | XM_006537943.3 | 46.5% | 46.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1452
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtagaatc aataagaacg tggttttggc ccttttaacg ctgacaagtt 121 ctgcatttct gctgtttcag ttgtactact acaagcacta tttatcaaca aagaatggag 181 ctggtttgtc aaaatccaaa ggaagccgaa ttggatttga tagcacacag tggcgtgcag 241 ttaaaaaatt tattatgtta acatccaacc aaaatgtacc agtgtttctt attgatcctt 301 tgatactgga attgattaat aagaactttg aacaagtcaa aaatacttct catggctcta 361 cttcacaatg caagtttttc tgtgttccaa gagactttac tgcatttgca ctgcagtatc 421 acctatggaa gaatgaggaa ggctggtttc ggatagctga gaatatggga tttcagtgcc 481 taaagattga gagtaaagat ccccggctag acgggataga ctcactctct ggaactgaaa 541 tccccctgca ctatatctgc aaactggcca ctcatgcgat ccacttggta gtctttcatg 601 agaggagtgg caactacctc tggcacggcc acttgagact taaagaacac attgacagga 661 aatttgttcc cttccgaaag ttacagtttg gtcgttatcc aggagctttt gacaggccag 721 agttacagca agttactgtt gatggactgg aagttctcat tccaaaggat ccaatgcact 781 ttgtagaaga agtaccacac tctaggttta ttgagtgtag gtataaagaa gctcgagcat 841 tctttcagca gtaccttgat gataacactg tggaagctgt ggcctttcgg aagagtgcaa 901 aggaattact gcaactagca gcgaaaacat taaacaaatt gggagtacca ttctggctga 961 gcagtggaac ttgtctagga tggtatcgac aatgcaacat tattccttat agcaaagatg 1021 ttgacctagg aatttttata caagattaca aatctgatat tattttagca tttcaggatg 1081 caggacttcc gctcaaacac aaatttggga aggtagaaga cagcttggaa ctaTCCTTCC 1141 AGGGAAAAGA TGATGTAAAA CTTGATGTTT TTTTCTTCTA TGAAGAAACT GATCACATGT 1201 GGAATGGAGG CACTCAGGCC AAAACAGGAA AAAAATTCAA ATACCTGTTT CCGAAGTTTA 1261 CACTGTGCTG GACTGAGTTT GTAGACATGA AGGTCCATGT ACCCTGTGAA ACCCTCGAAT 1321 ACATTGAAGC CAACTATGGT AAGACCTGGA AGATTCCTGT AAAGACGTGG GACTGGAAGC 1381 GCTCTCCTCC CAATGTGCAA CCCAATGGAA TCTGGCCTAT TTCTGAGTGG GATGAGGTTA 1441 TCCAGTTATA TTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTC 1561 GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATATC TTTCCCAATC GAGACGCCGT 1621 ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt