Transcript: Human XM_017014565.2

PREDICTED: Homo sapiens folylpolyglutamate synthase (FPGS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FPGS (2356)
Length:
1844
CDS:
215..1567

Additional Resources:

NCBI RefSeq record:
XM_017014565.2
NBCI Gene record:
FPGS (2356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257198 ATGCCGTGCGCATGCTCAATA pLKO_005 204 5UTR 100% 13.200 18.480 N FPGS n/a
2 TRCN0000045929 CTGTGCCTTCACGGAATGTAT pLKO.1 394 CDS 100% 5.625 7.875 N FPGS n/a
3 TRCN0000045928 CCAGTTTGACTATGCCGTCTT pLKO.1 1357 CDS 100% 4.050 5.670 N FPGS n/a
4 TRCN0000045931 TCACGGAATGTATCCTCCGAA pLKO.1 402 CDS 100% 2.640 3.696 N FPGS n/a
5 TRCN0000244999 GCCTGAAGACGGGATTCTTTA pLKO_005 429 CDS 100% 13.200 9.240 N FPGS n/a
6 TRCN0000245001 AGCCCTGCCAGTTTGACTATG pLKO_005 1350 CDS 100% 10.800 7.560 N FPGS n/a
7 TRCN0000245000 TTCGAGTCTTGCTCTTCAATG pLKO_005 1287 CDS 100% 10.800 7.560 N FPGS n/a
8 TRCN0000045930 TCAGACACAGTTGGAAGCCAT pLKO.1 280 CDS 100% 2.640 1.848 N FPGS n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1724 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1725 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.