Transcript: Human XM_017014656.1

PREDICTED: Homo sapiens odorant binding protein 2A (OBP2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OBP2A (29991)
Length:
1630
CDS:
763..1605

Additional Resources:

NCBI RefSeq record:
XM_017014656.1
NBCI Gene record:
OBP2A (29991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059729 GAATCCTAATACCAACCTGGA pLKO.1 1376 CDS 100% 2.160 3.024 N OBP2A n/a
2 TRCN0000059732 GATCGGTGCATCCAGAAGAAA pLKO.1 1132 CDS 100% 5.625 3.375 N OBP2A n/a
3 TRCN0000059730 CCTGGCAAATTCAGCGCCTAT pLKO.1 1177 CDS 100% 4.050 2.430 N OBP2A n/a
4 TRCN0000378861 GAACTTGGAAGCCACGTTCAC pLKO_005 1098 CDS 100% 4.050 2.430 N OBP2A n/a
5 TRCN0000250150 GGAGGCCCTGGAAGAATTTAA pLKO_005 1394 CDS 100% 15.000 7.500 Y OBP2B n/a
6 TRCN0000059728 CCCTGGAAGAATTTAAGAAAT pLKO.1 1399 CDS 100% 13.200 6.600 Y OBP2A n/a
7 TRCN0000250153 GACTCTCGGAGGAGGACATTT pLKO_005 1435 CDS 100% 13.200 6.600 Y OBP2B n/a
8 TRCN0000250152 GAAGGCCATGGTGGTCGATAA pLKO_005 1011 CDS 100% 10.800 5.400 Y OBP2B n/a
9 TRCN0000378935 TGGTGGTCGATAAGGACTTTC pLKO_005 1019 CDS 100% 10.800 5.400 Y OBP2A n/a
10 TRCN0000378859 TGGAGGAGGAGGATATCACAG pLKO_005 977 CDS 100% 4.050 2.025 Y OBP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03125 pDONR223 100% 60.7% 46.4% None 1_156del;544_608del;732_840del n/a
2 ccsbBroad304_03125 pLX_304 0% 60.7% 46.4% V5 1_156del;544_608del;732_840del n/a
3 TRCN0000476475 GCCCTAAGATTCAAAGCCGCAAAT pLX_317 60% 60.7% 46.4% V5 1_156del;544_608del;732_840del n/a
Download CSV