Transcript: Human XM_017014797.1

PREDICTED: Homo sapiens EGF like domain multiple 7 (EGFL7), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EGFL7 (51162)
Length:
2287
CDS:
1236..1895

Additional Resources:

NCBI RefSeq record:
XM_017014797.1
NBCI Gene record:
EGFL7 (51162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053659 GCACCTACCGAACCATCTATA pLKO.1 1423 CDS 100% 13.200 18.480 N EGFL7 n/a
2 TRCN0000372058 TGCAAGAAAGACTCGTGACTG pLKO_005 1878 CDS 100% 4.050 5.670 N EGFL7 n/a
3 TRCN0000053661 AGGAGTGGACAGTGCAATGAA pLKO.1 1643 CDS 100% 5.625 3.938 N EGFL7 n/a
4 TRCN0000053662 CGAGCAGATTTCCTTCCTGGA pLKO.1 1835 CDS 100% 2.160 1.512 N EGFL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08236 pDONR223 100% 80.2% 80.2% None 406_407ins162 n/a
2 ccsbBroad304_08236 pLX_304 0% 80.2% 80.2% V5 406_407ins162 n/a
3 TRCN0000474432 AAATTCCAGCTATTAGCTTCGAGT pLX_317 48.7% 80.2% 80.2% V5 406_407ins162 n/a
Download CSV