Transcript: Human XM_017015043.1

PREDICTED: Homo sapiens solute carrier family 1 member 1 (SLC1A1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC1A1 (6505)
Length:
3592
CDS:
215..1681

Additional Resources:

NCBI RefSeq record:
XM_017015043.1
NBCI Gene record:
SLC1A1 (6505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255381 GTAATTCTCCCGCTGATATAT pLKO_005 1001 CDS 100% 15.000 21.000 N SLC1A1 n/a
2 TRCN0000265645 AGAGTAAATCCCACGACATAA pLKO_005 2900 3UTR 100% 13.200 18.480 N SLC1A1 n/a
3 TRCN0000255382 TCTGCGCGCTGTCGTGTATTA pLKO_005 487 CDS 100% 13.200 18.480 N SLC1A1 n/a
4 TRCN0000043344 CGTTGGTGCAACAATCAACAT pLKO.1 1186 CDS 100% 4.950 6.930 N SLC1A1 n/a
5 TRCN0000043347 CATTGCTGTTATTCTAGGTAT pLKO.1 523 CDS 100% 4.950 3.960 N SLC1A1 n/a
6 TRCN0000255383 GGATGCTGAAACTCATCATTT pLKO_005 396 CDS 100% 13.200 9.240 N SLC1A1 n/a
7 TRCN0000043345 CCTTGTCTTTGGACTTGTCAT pLKO.1 871 CDS 100% 4.950 3.465 N SLC1A1 n/a
8 TRCN0000043343 GCCATTAATTATATCCAGCAT pLKO.1 418 CDS 100% 2.640 1.848 N SLC1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06954 pDONR223 100% 93% 92.9% None 274C>G;766_767ins108 n/a
2 ccsbBroad304_06954 pLX_304 0% 93% 92.9% V5 274C>G;766_767ins108 n/a
3 TRCN0000481203 CTGATTTCTGGCCTATTCTCAGTC pLX_317 26% 93% 92.9% V5 274C>G;766_767ins108 n/a
Download CSV