Transcript: Human XM_017015187.1

PREDICTED: Homo sapiens fibronectin type III and SPRY domain containing 1 like (FSD1L), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FSD1L (83856)
Length:
7185
CDS:
183..1136

Additional Resources:

NCBI RefSeq record:
XM_017015187.1
NBCI Gene record:
FSD1L (83856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154399 CGTCTTGATTAGGTGGCCTTT pLKO.1 1264 3UTR 100% 4.050 5.670 N FSD1L n/a
2 TRCN0000150968 GCGTTCTTAAAGGTCTCTAAA pLKO.1 3583 3UTR 100% 13.200 10.560 N FSD1L n/a
3 TRCN0000248850 TCATTTCAACTCTGGCAAATA pLKO_005 214 CDS 100% 13.200 9.240 N Fsd1l n/a
4 TRCN0000150964 GAGTTACAGAGTCAGATTAGT pLKO.1 417 CDS 100% 5.625 3.938 N FSD1L n/a
5 TRCN0000152176 CATACTCTCAGAGTTAGATGA pLKO.1 308 CDS 100% 4.950 3.465 N FSD1L n/a
6 TRCN0000155790 CCTGGAGAACTCTGAAGAACT pLKO.1 452 CDS 100% 4.950 3.465 N FSD1L n/a
7 TRCN0000151049 GCAGTTACTAATCACAGGAAT pLKO.1 1290 3UTR 100% 4.950 3.465 N FSD1L n/a
8 TRCN0000152671 GTCCAACATACTCTCAGAGTT pLKO.1 302 CDS 100% 4.950 3.465 N FSD1L n/a
9 TRCN0000150585 GATCATTTCAACTCTGGCAAA pLKO.1 212 CDS 100% 4.050 2.835 N FSD1L n/a
10 TRCN0000155955 CGTCCAACATACTCTCAGAGT pLKO.1 301 CDS 100% 2.640 1.848 N FSD1L n/a
11 TRCN0000153408 GAACAAGCTCGTAAATCCCAA pLKO.1 396 CDS 100% 2.640 1.848 N FSD1L n/a
12 TRCN0000151170 GATTAACTGTATCAAGCAGGA pLKO.1 377 CDS 100% 2.160 1.512 N FSD1L n/a
13 TRCN0000155866 CCAAGTGCTGTGAGAACACTT pLKO.1 1154 3UTR 100% 0.495 0.347 N FSD1L n/a
14 TRCN0000150569 GCCTTCTTTCTTCTGTACTTT pLKO.1 1593 3UTR 100% 5.625 3.375 N FSD1L n/a
15 TRCN0000248853 CAACAAGGTCATTAGATATTA pLKO_005 484 CDS 100% 15.000 10.500 N Fsd1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12756 pDONR223 100% 25% 24.8% None (many diffs) n/a
2 ccsbBroad304_12756 pLX_304 0% 25% 24.8% V5 (many diffs) n/a
3 TRCN0000468566 TCTATTTTATTCCGACCATGGTTT pLX_317 49.8% 25% 24.8% V5 (many diffs) n/a
Download CSV