Transcript: Human XM_017015341.1

PREDICTED: Homo sapiens G protein subunit alpha 14 (GNA14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNA14 (9630)
Length:
2019
CDS:
214..1119

Additional Resources:

NCBI RefSeq record:
XM_017015341.1
NBCI Gene record:
GNA14 (9630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036879 CCAGAATACACAGGACCGAAA pLKO.1 916 CDS 100% 4.050 3.240 N GNA14 n/a
2 TRCN0000036882 GAAGAGAGCAAAGCCTTATTT pLKO.1 784 CDS 100% 15.000 10.500 N GNA14 n/a
3 TRCN0000036880 GCTGCTGTCAAAGACACAATT pLKO.1 1063 CDS 100% 13.200 9.240 N GNA14 n/a
4 TRCN0000036881 GTGTGTGAACAGAATAAGGAA pLKO.1 343 CDS 100% 3.000 2.100 N GNA14 n/a
5 TRCN0000036883 TGCTACAGATACAGACAATAT pLKO.1 1029 CDS 100% 13.200 7.920 N GNA14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14942 pDONR223 97.8% 84.6% 84.5% None 0_1ins162;891A>T n/a
2 ccsbBroad304_14942 pLX_304 0% 84.6% 84.5% V5 0_1ins162;891A>T n/a
3 TRCN0000469606 AAGCACGTCTTTTGCCCATGGCGC pLX_317 36.3% 84.6% 83.3% V5 (not translated due to prior stop codon) 0_1ins162;890delA;897delC n/a
Download CSV