Transcript: Human XM_017015354.1

PREDICTED: Homo sapiens tripartite motif containing 14 (TRIM14), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM14 (9830)
Length:
3470
CDS:
222..1115

Additional Resources:

NCBI RefSeq record:
XM_017015354.1
NBCI Gene record:
TRIM14 (9830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061828 GCCCGTCAAGAGCTTCTTTAA pLKO.1 839 CDS 100% 13.200 18.480 N TRIM14 n/a
2 TRCN0000061829 GCGATCGCTATTGCTGAAATA pLKO.1 995 CDS 100% 13.200 18.480 N TRIM14 n/a
3 TRCN0000415906 GAAGCCGTGGAGAGTACATTA pLKO_005 870 CDS 100% 13.200 9.240 N TRIM14 n/a
4 TRCN0000061830 GCTAATGCAGAGTCAAGTAAA pLKO.1 525 CDS 100% 13.200 9.240 N TRIM14 n/a
5 TRCN0000061831 GCCATTGGACATTCGCCTTAA pLKO.1 896 CDS 100% 10.800 7.560 N TRIM14 n/a
6 TRCN0000412888 GACAACATAACCCAGATAGAA pLKO_005 483 CDS 100% 5.625 3.938 N TRIM14 n/a
7 TRCN0000061832 CTCAGATTACTACTTGACGAA pLKO.1 573 CDS 100% 2.640 1.848 N TRIM14 n/a
8 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2108 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
9 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 2115 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
10 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 2114 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.