Transcript: Human XM_017015376.1

PREDICTED: Homo sapiens ribosome biogenesis protein BMS1 homolog (LOC101929959), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101929959 (101929959)
Length:
1610
CDS:
233..1138

Additional Resources:

NCBI RefSeq record:
XM_017015376.1
NBCI Gene record:
LOC101929959 (101929959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146331 CCCAGTAACATCTTTGTTGAA pLKO.1 1243 3UTR 100% 4.950 2.475 Y BMS1 n/a
2 TRCN0000278475 CCCAGTAACATCTTTGTTGAA pLKO_005 1243 3UTR 100% 4.950 2.475 Y BMS1 n/a
3 TRCN0000168428 GAAGACCACAATGGAAGACAA pLKO.1 788 CDS 100% 4.950 2.475 Y BMS1P20 n/a
4 TRCN0000167923 CAATGGAAGACAAAGGCTTCT pLKO.1 796 CDS 100% 4.050 2.025 Y BMS1P20 n/a
5 TRCN0000172365 CGAAGACCACAATGGAAGACA pLKO.1 787 CDS 100% 3.000 1.500 Y BMS1P20 n/a
6 TRCN0000168108 CACAATGGAAGACAAAGGCTT pLKO.1 794 CDS 100% 2.640 1.320 Y BMS1P20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07487 pDONR223 100% 20.5% 17.1% None (many diffs) n/a
2 ccsbBroad304_07487 pLX_304 0% 20.5% 17.1% V5 (many diffs) n/a
3 TRCN0000480950 GACCCCTCCATCATAGCGCCCGAA pLX_317 10.1% 20.5% 17.1% V5 (many diffs) n/a
Download CSV