Transcript: Human XM_017015380.1

PREDICTED: Homo sapiens contactin associated protein like 3C (CNTNAP3C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTNAP3C (100289279)
Length:
2124
CDS:
377..1921

Additional Resources:

NCBI RefSeq record:
XM_017015380.1
NBCI Gene record:
CNTNAP3C (100289279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426667 AGTGTACGGATGTGCATATAA pLKO_005 895 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
2 TRCN0000424272 GGAGTGGATGTTACCGAATTA pLKO_005 1394 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
3 TRCN0000424833 TTCCAGTTACTTGGATCTTAA pLKO_005 1276 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
4 TRCN0000119184 CAGATCCTCATGATGGGAAAT pLKO.1 1433 CDS 100% 10.800 5.400 Y CNTNAP3 n/a
5 TRCN0000119186 ACAGAGCAGGACATTTGCTTT pLKO.1 1581 CDS 100% 4.950 2.475 Y CNTNAP3 n/a
6 TRCN0000119183 CCTCTTTCTTAAGGATGGCAA pLKO.1 1636 CDS 100% 2.640 1.320 Y CNTNAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12646 pDONR223 100% 41.6% 41.2% None (many diffs) n/a
2 ccsbBroad304_12646 pLX_304 0% 41.6% 41.2% V5 (many diffs) n/a
3 TRCN0000476859 AGTTTCTCGCGGTACGTTTCCTTC pLX_317 12.5% 41.6% 41.2% V5 (many diffs) n/a
Download CSV