Transcript: Human XM_017015663.1

PREDICTED: Homo sapiens sideroflexin 2 (SFXN2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFXN2 (118980)
Length:
1030
CDS:
375..935

Additional Resources:

NCBI RefSeq record:
XM_017015663.1
NBCI Gene record:
SFXN2 (118980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059486 TGCGGCTAACTGTGTCAATAT pLKO.1 907 CDS 100% 13.200 18.480 N SFXN2 n/a
2 TRCN0000425044 GCATGATCATCACGGGCTTCA pLKO_005 724 CDS 100% 4.050 3.240 N SFXN2 n/a
3 TRCN0000059487 GAGAGTGAAGCACTTCCTAAA pLKO.1 494 CDS 100% 10.800 7.560 N SFXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04734 pDONR223 100% 49.4% 41.9% None 1_54del;483_484ins76;558_559ins386 n/a
2 ccsbBroad304_04734 pLX_304 0% 49.4% 41.9% V5 1_54del;483_484ins76;558_559ins386 n/a
3 TRCN0000473648 CATCACTCCGAAACTTCTTTGTGG pLX_317 44.6% 49.4% 41.9% V5 1_54del;483_484ins76;558_559ins386 n/a
Download CSV