Transcript: Human XM_017015843.1

PREDICTED: Homo sapiens rhotekin 2 (RTKN2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTKN2 (219790)
Length:
1871
CDS:
270..1856

Additional Resources:

NCBI RefSeq record:
XM_017015843.1
NBCI Gene record:
RTKN2 (219790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130576 CAGCTTTGGTAGTACCCATTA pLKO.1 1264 CDS 100% 10.800 15.120 N RTKN2 n/a
2 TRCN0000426439 GATCACGACGCTATGCCATTT pLKO_005 640 CDS 100% 10.800 15.120 N RTKN2 n/a
3 TRCN0000147888 GAGCATTGATTCACCTATGAA pLKO.1 1667 CDS 100% 5.625 7.875 N RTKN2 n/a
4 TRCN0000435969 CCATATCAGATATTCGAATAC pLKO_005 577 CDS 100% 10.800 7.560 N RTKN2 n/a
5 TRCN0000129726 CAAGACCCATAATCTGTCTAT pLKO.1 1019 CDS 100% 4.950 3.465 N RTKN2 n/a
6 TRCN0000149095 GACTGGAAGATGTGATGTGAA pLKO.1 515 CDS 100% 4.950 2.970 N RTKN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473774 CTGTGCGCGCGTAAGAGCCGTCGA pLX_317 92.1% 30.7% 29.5% V5 (not translated due to prior stop codon) 468delT;489_1584delinsG n/a
2 ccsbBroadEn_14437 pDONR223 100% 30.6% 30.3% None 468T>N;473A>N;489_1584delinsG n/a
3 ccsbBroad304_14437 pLX_304 0% 30.6% 30.3% V5 468T>N;473A>N;489_1584delinsG n/a
Download CSV