Transcript: Human XM_017015879.1

PREDICTED: Homo sapiens zinc finger protein 438 (ZNF438), transcript variant X34, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF438 (220929)
Length:
2371
CDS:
999..2177

Additional Resources:

NCBI RefSeq record:
XM_017015879.1
NBCI Gene record:
ZNF438 (220929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017111 GCCCTTACAGTTGTCGGATTT pLKO.1 1288 CDS 100% 10.800 15.120 N ZNF438 n/a
2 TRCN0000435442 GCTTAGTCACAAAGATCAAAC pLKO_005 2253 3UTR 100% 10.800 15.120 N ZNF438 n/a
3 TRCN0000414493 ATAAGCTCTCGAAGCATATTT pLKO_005 2342 3UTR 100% 15.000 10.500 N ZNF438 n/a
4 TRCN0000412556 CCTTCAGAGCTTCGTGCTTTA pLKO_005 2225 3UTR 100% 10.800 7.560 N ZNF438 n/a
5 TRCN0000017108 GCGTGGAAATGCTCATGGAAA pLKO.1 1897 CDS 100% 4.950 3.465 N ZNF438 n/a
6 TRCN0000429240 TAATTCACTCACTCCTAAATA pLKO_005 1103 CDS 100% 15.000 9.000 N ZNF438 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05245 pDONR223 100% 47.3% 47.3% None 0_1ins1308 n/a
2 ccsbBroad304_05245 pLX_304 0% 47.3% 47.3% V5 0_1ins1308 n/a
3 TRCN0000477191 GATCCATGTGGTAGGCTTAGGGCC pLX_317 13.8% 47.3% 47.3% V5 0_1ins1308 n/a
Download CSV