Transcript: Human XM_017015891.1

PREDICTED: Homo sapiens family with sequence similarity 13 member C (FAM13C), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM13C (220965)
Length:
3450
CDS:
555..1769

Additional Resources:

NCBI RefSeq record:
XM_017015891.1
NBCI Gene record:
FAM13C (220965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420634 TCTTGACCATCTCCGAGAAAC pLKO_005 1553 CDS 100% 10.800 15.120 N FAM13C n/a
2 TRCN0000179084 CGCTTTATGACCGATACAGAA pLKO.1 1279 CDS 100% 4.950 6.930 N FAM13C n/a
3 TRCN0000423172 ATACAACAGGTAGCCATATAA pLKO_005 1957 3UTR 100% 15.000 12.000 N FAM13C n/a
4 TRCN0000415926 GCTAGCAAGAAAGCAATTTAT pLKO_005 2211 3UTR 100% 15.000 10.500 N FAM13C n/a
5 TRCN0000146804 CCTTCCCTTATTCCAACAATT pLKO.1 1323 CDS 100% 13.200 9.240 N FAM13C n/a
6 TRCN0000217691 GTGCGACTTCAACCAAGAATA pLKO.1 732 CDS 100% 13.200 9.240 N Fam13c n/a
7 TRCN0000128990 GAACCTCATAAAGCCGCTTTA pLKO.1 1265 CDS 100% 10.800 7.560 N FAM13C n/a
8 TRCN0000130859 GAAGCCCAAGTCCATCTTCAA pLKO.1 575 CDS 100% 4.950 3.465 N FAM13C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05246 pDONR223 100% 82.9% 82.9% None 0_1ins249 n/a
2 ccsbBroad304_05246 pLX_304 0% 82.9% 82.9% V5 0_1ins249 n/a
3 TRCN0000478166 GTGCACATTTGCTGCCGACCAACA pLX_317 14.4% 82.9% 82.9% V5 0_1ins249 n/a
4 ccsbBroadEn_09861 pDONR223 100% 69% 69% None 0_1ins249;692_693ins294 n/a
5 ccsbBroad304_09861 pLX_304 0% 69% 69% V5 0_1ins249;692_693ins294 n/a
6 TRCN0000480797 ATTGTAGACACCCAGCCTCTTCTG pLX_317 23.4% 69% 69% V5 0_1ins249;692_693ins294 n/a
Download CSV