Transcript: Human XM_017015932.1

PREDICTED: Homo sapiens ankyrin repeat domain 26 (ANKRD26), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD26 (22852)
Length:
6686
CDS:
173..6268

Additional Resources:

NCBI RefSeq record:
XM_017015932.1
NBCI Gene record:
ANKRD26 (22852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160187 CCTTCCTACAACATCAATCAA pLKO.1 1138 CDS 100% 5.625 7.875 N ANKRD26 n/a
2 TRCN0000158729 GAGCAGTTTAGAGAGAATAAT pLKO.1 5792 CDS 100% 15.000 10.500 N ANKRD26 n/a
3 TRCN0000159912 CACAAACAATATCCCAGTATA pLKO.1 4161 CDS 100% 13.200 9.240 N ANKRD26 n/a
4 TRCN0000159304 GATTAGGACAAGAGGAAGATA pLKO.1 1398 CDS 100% 5.625 3.938 N ANKRD26 n/a
5 TRCN0000162793 CCAGCTCAATGTCTGTGACAA pLKO.1 484 CDS 100% 4.950 3.465 N ANKRD26 n/a
6 TRCN0000160163 CTTGAACGATAGAGACAAGAT pLKO.1 388 CDS 100% 4.950 3.465 N ANKRD26 n/a
7 TRCN0000159705 GACAAGGTTAATGTACTACAA pLKO.1 3530 CDS 100% 4.950 3.465 N ANKRD26 n/a
8 TRCN0000161243 GCTACTGATGATGCTGAAGAT pLKO.1 2960 CDS 100% 4.950 3.465 N ANKRD26 n/a
9 TRCN0000162599 CAGTAGCAACAAAGCTGCTTT pLKO.1 651 CDS 100% 4.950 2.970 N ANKRD26 n/a
10 TRCN0000167035 CAAGGCAAATTAGAGTGGAAA pLKO.1 2003 CDS 100% 4.950 2.475 Y CCDC144B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11635 pDONR223 100% 77% 76.9% None (many diffs) n/a
2 ccsbBroad304_11635 pLX_304 0% 77% 76.9% V5 (many diffs) n/a
3 TRCN0000477849 CAGGACGTTATTTGAGACCTGTGT pLX_317 10.3% 77% 76.9% V5 (many diffs) n/a
Download CSV